ID: 1066221169

View in Genome Browser
Species Human (GRCh38)
Location 10:33336699-33336721
Sequence CGCGCCCAGCGCAGACCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066221153_1066221169 26 Left 1066221153 10:33336650-33336672 CCTGCGCCCGGGCAGGCGGGCAG No data
Right 1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG No data
1066221152_1066221169 27 Left 1066221152 10:33336649-33336671 CCCTGCGCCCGGGCAGGCGGGCA No data
Right 1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG No data
1066221158_1066221169 19 Left 1066221158 10:33336657-33336679 CCGGGCAGGCGGGCAGGCGGGAG No data
Right 1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG No data
1066221157_1066221169 20 Left 1066221157 10:33336656-33336678 CCCGGGCAGGCGGGCAGGCGGGA No data
Right 1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066221169 Original CRISPR CGCGCCCAGCGCAGACCCCG GGG Intergenic
No off target data available for this crispr