ID: 1066230147

View in Genome Browser
Species Human (GRCh38)
Location 10:33424234-33424256
Sequence TGTCTCTGCTTCACAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066230147_1066230148 -6 Left 1066230147 10:33424234-33424256 CCAGACACTGTGAAGCAGAGACA No data
Right 1066230148 10:33424251-33424273 GAGACAAGCCATCCTCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066230147 Original CRISPR TGTCTCTGCTTCACAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr