ID: 1066232131

View in Genome Browser
Species Human (GRCh38)
Location 10:33446109-33446131
Sequence GCATATAAACTGAAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066232131_1066232133 9 Left 1066232131 10:33446109-33446131 CCATCATCCTTCAGTTTATATGC No data
Right 1066232133 10:33446141-33446163 TTACCATGTCTACCTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066232131 Original CRISPR GCATATAAACTGAAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr