ID: 1066232133

View in Genome Browser
Species Human (GRCh38)
Location 10:33446141-33446163
Sequence TTACCATGTCTACCTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066232131_1066232133 9 Left 1066232131 10:33446109-33446131 CCATCATCCTTCAGTTTATATGC No data
Right 1066232133 10:33446141-33446163 TTACCATGTCTACCTCAAACAGG No data
1066232132_1066232133 2 Left 1066232132 10:33446116-33446138 CCTTCAGTTTATATGCATGCAAC No data
Right 1066232133 10:33446141-33446163 TTACCATGTCTACCTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066232133 Original CRISPR TTACCATGTCTACCTCAAAC AGG Intergenic
No off target data available for this crispr