ID: 1066233768

View in Genome Browser
Species Human (GRCh38)
Location 10:33465451-33465473
Sequence TCTGCTGCAAATTAATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066233767_1066233768 4 Left 1066233767 10:33465424-33465446 CCAAGAGCTCTGTGTTCTAGTCT No data
Right 1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG No data
1066233766_1066233768 5 Left 1066233766 10:33465423-33465445 CCCAAGAGCTCTGTGTTCTAGTC No data
Right 1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG No data
1066233765_1066233768 29 Left 1066233765 10:33465399-33465421 CCAAAGATAAGCAATGGTTTGGT No data
Right 1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066233768 Original CRISPR TCTGCTGCAAATTAATTGCC TGG Intergenic
No off target data available for this crispr