ID: 1066245312

View in Genome Browser
Species Human (GRCh38)
Location 10:33577500-33577522
Sequence CTGTAGTCCTAGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8713
Summary {0: 3, 1: 30, 2: 170, 3: 1341, 4: 7169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066245304_1066245312 27 Left 1066245304 10:33577450-33577472 CCCTGTCTCTACTAAAAACACAA 0: 2644
1: 69443
2: 166474
3: 191219
4: 126697
Right 1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG 0: 3
1: 30
2: 170
3: 1341
4: 7169
1066245305_1066245312 26 Left 1066245305 10:33577451-33577473 CCTGTCTCTACTAAAAACACAAA 0: 6301
1: 173952
2: 213474
3: 129693
4: 84145
Right 1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG 0: 3
1: 30
2: 170
3: 1341
4: 7169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066245312 Original CRISPR CTGTAGTCCTAGCACTCAGG AGG Intergenic
Too many off-targets to display for this crispr