ID: 1066245312 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:33577500-33577522 |
| Sequence | CTGTAGTCCTAGCACTCAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 8713 | |||
| Summary | {0: 3, 1: 30, 2: 170, 3: 1341, 4: 7169} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066245304_1066245312 | 27 | Left | 1066245304 | 10:33577450-33577472 | CCCTGTCTCTACTAAAAACACAA | 0: 2644 1: 69443 2: 166474 3: 191219 4: 126697 |
||
| Right | 1066245312 | 10:33577500-33577522 | CTGTAGTCCTAGCACTCAGGAGG | 0: 3 1: 30 2: 170 3: 1341 4: 7169 |
||||
| 1066245305_1066245312 | 26 | Left | 1066245305 | 10:33577451-33577473 | CCTGTCTCTACTAAAAACACAAA | 0: 6301 1: 173952 2: 213474 3: 129693 4: 84145 |
||
| Right | 1066245312 | 10:33577500-33577522 | CTGTAGTCCTAGCACTCAGGAGG | 0: 3 1: 30 2: 170 3: 1341 4: 7169 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066245312 | Original CRISPR | CTGTAGTCCTAGCACTCAGG AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||