ID: 1066246839

View in Genome Browser
Species Human (GRCh38)
Location 10:33591964-33591986
Sequence CGGCAGACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066246829_1066246839 24 Left 1066246829 10:33591917-33591939 CCCTGCTGGATCCAGAGGGATGG No data
Right 1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG No data
1066246831_1066246839 23 Left 1066246831 10:33591918-33591940 CCTGCTGGATCCAGAGGGATGGA 0: 14
1: 44
2: 107
3: 135
4: 303
Right 1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG No data
1066246833_1066246839 13 Left 1066246833 10:33591928-33591950 CCAGAGGGATGGAAGTCAGTGGC No data
Right 1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066246839 Original CRISPR CGGCAGACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr