ID: 1066250309

View in Genome Browser
Species Human (GRCh38)
Location 10:33626608-33626630
Sequence CAAATCATGAAATAGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066250309_1066250312 -6 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250312 10:33626625-33626647 GATTTGCTTTAAGCCAAGCTGGG No data
1066250309_1066250311 -7 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250311 10:33626624-33626646 TGATTTGCTTTAAGCCAAGCTGG No data
1066250309_1066250314 18 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250314 10:33626649-33626671 AGAACTGACCTCTGAGCTGTAGG No data
1066250309_1066250316 26 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250316 10:33626657-33626679 CCTCTGAGCTGTAGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066250309 Original CRISPR CAAATCATGAAATAGGTAAC TGG (reversed) Intergenic
No off target data available for this crispr