ID: 1066250311

View in Genome Browser
Species Human (GRCh38)
Location 10:33626624-33626646
Sequence TGATTTGCTTTAAGCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066250309_1066250311 -7 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250311 10:33626624-33626646 TGATTTGCTTTAAGCCAAGCTGG No data
1066250308_1066250311 8 Left 1066250308 10:33626593-33626615 CCAAACAAATCTTCACCAGTTAC No data
Right 1066250311 10:33626624-33626646 TGATTTGCTTTAAGCCAAGCTGG No data
1066250307_1066250311 9 Left 1066250307 10:33626592-33626614 CCCAAACAAATCTTCACCAGTTA No data
Right 1066250311 10:33626624-33626646 TGATTTGCTTTAAGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066250311 Original CRISPR TGATTTGCTTTAAGCCAAGC TGG Intergenic
No off target data available for this crispr