ID: 1066250312

View in Genome Browser
Species Human (GRCh38)
Location 10:33626625-33626647
Sequence GATTTGCTTTAAGCCAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066250309_1066250312 -6 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250312 10:33626625-33626647 GATTTGCTTTAAGCCAAGCTGGG No data
1066250308_1066250312 9 Left 1066250308 10:33626593-33626615 CCAAACAAATCTTCACCAGTTAC No data
Right 1066250312 10:33626625-33626647 GATTTGCTTTAAGCCAAGCTGGG No data
1066250307_1066250312 10 Left 1066250307 10:33626592-33626614 CCCAAACAAATCTTCACCAGTTA No data
Right 1066250312 10:33626625-33626647 GATTTGCTTTAAGCCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066250312 Original CRISPR GATTTGCTTTAAGCCAAGCT GGG Intergenic
No off target data available for this crispr