ID: 1066250316

View in Genome Browser
Species Human (GRCh38)
Location 10:33626657-33626679
Sequence CCTCTGAGCTGTAGGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066250310_1066250316 19 Left 1066250310 10:33626615-33626637 CCTATTTCATGATTTGCTTTAAG No data
Right 1066250316 10:33626657-33626679 CCTCTGAGCTGTAGGACCTGAGG No data
1066250309_1066250316 26 Left 1066250309 10:33626608-33626630 CCAGTTACCTATTTCATGATTTG No data
Right 1066250316 10:33626657-33626679 CCTCTGAGCTGTAGGACCTGAGG No data
1066250313_1066250316 -4 Left 1066250313 10:33626638-33626660 CCAAGCTGGGTAGAACTGACCTC No data
Right 1066250316 10:33626657-33626679 CCTCTGAGCTGTAGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066250316 Original CRISPR CCTCTGAGCTGTAGGACCTG AGG Intergenic
No off target data available for this crispr