ID: 1066253394

View in Genome Browser
Species Human (GRCh38)
Location 10:33655565-33655587
Sequence CTGGAGTTCTTGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066253394_1066253403 27 Left 1066253394 10:33655565-33655587 CCTCCTTTCCTCAAGAACTCCAG No data
Right 1066253403 10:33655615-33655637 CACCTCCCAGGTCTCTGCACAGG No data
1066253394_1066253400 15 Left 1066253394 10:33655565-33655587 CCTCCTTTCCTCAAGAACTCCAG No data
Right 1066253400 10:33655603-33655625 CCGTCTCCCTCTCACCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066253394 Original CRISPR CTGGAGTTCTTGAGGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr