ID: 1066254199

View in Genome Browser
Species Human (GRCh38)
Location 10:33662812-33662834
Sequence AGACCCCCGATTGCAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066254189_1066254199 25 Left 1066254189 10:33662764-33662786 CCTGCCTCTTTCTGGCTCTTTCC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254191_1066254199 4 Left 1066254191 10:33662785-33662807 CCCTCCTACCTACCTTCAAACAG No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254188_1066254199 26 Left 1066254188 10:33662763-33662785 CCCTGCCTCTTTCTGGCTCTTTC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254192_1066254199 3 Left 1066254192 10:33662786-33662808 CCTCCTACCTACCTTCAAACAGC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254194_1066254199 -4 Left 1066254194 10:33662793-33662815 CCTACCTTCAAACAGCCAAAGAC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254195_1066254199 -8 Left 1066254195 10:33662797-33662819 CCTTCAAACAGCCAAAGACCCCC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254190_1066254199 21 Left 1066254190 10:33662768-33662790 CCTCTTTCTGGCTCTTTCCCTCC No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data
1066254193_1066254199 0 Left 1066254193 10:33662789-33662811 CCTACCTACCTTCAAACAGCCAA No data
Right 1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066254199 Original CRISPR AGACCCCCGATTGCAAGGAA GGG Intergenic
No off target data available for this crispr