ID: 1066258489

View in Genome Browser
Species Human (GRCh38)
Location 10:33705190-33705212
Sequence GCAACTTCATCACAGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066258489_1066258495 14 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258495 10:33705227-33705249 TTATAAGATCAGGGGACTGGTGG No data
1066258489_1066258490 4 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258490 10:33705217-33705239 ACCTCTAGTATTATAAGATCAGG No data
1066258489_1066258492 5 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258492 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
1066258489_1066258493 6 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258493 10:33705219-33705241 CTCTAGTATTATAAGATCAGGGG No data
1066258489_1066258494 11 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258494 10:33705224-33705246 GTATTATAAGATCAGGGGACTGG No data
1066258489_1066258496 19 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258496 10:33705232-33705254 AGATCAGGGGACTGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066258489 Original CRISPR GCAACTTCATCACAGCAATA AGG (reversed) Intergenic
No off target data available for this crispr