ID: 1066258491

View in Genome Browser
Species Human (GRCh38)
Location 10:33705218-33705240
Sequence CCCTGATCTTATAATACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066258491_1066258500 27 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258500 10:33705268-33705290 TGGCTATTGCATTTCTAATGAGG No data
1066258491_1066258498 7 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258498 10:33705248-33705270 GGCCTGGACTGAAGCTCAGGTGG No data
1066258491_1066258496 -9 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258496 10:33705232-33705254 AGATCAGGGGACTGGTGGCCTGG No data
1066258491_1066258497 4 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258497 10:33705245-33705267 GGTGGCCTGGACTGAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066258491 Original CRISPR CCCTGATCTTATAATACTAG AGG (reversed) Intergenic