ID: 1066258496

View in Genome Browser
Species Human (GRCh38)
Location 10:33705232-33705254
Sequence AGATCAGGGGACTGGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066258491_1066258496 -9 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258496 10:33705232-33705254 AGATCAGGGGACTGGTGGCCTGG No data
1066258489_1066258496 19 Left 1066258489 10:33705190-33705212 CCTTATTGCTGTGATGAAGTTGC No data
Right 1066258496 10:33705232-33705254 AGATCAGGGGACTGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066258496 Original CRISPR AGATCAGGGGACTGGTGGCC TGG Intergenic
No off target data available for this crispr