ID: 1066258498

View in Genome Browser
Species Human (GRCh38)
Location 10:33705248-33705270
Sequence GGCCTGGACTGAAGCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066258491_1066258498 7 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258498 10:33705248-33705270 GGCCTGGACTGAAGCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066258498 Original CRISPR GGCCTGGACTGAAGCTCAGG TGG Intergenic
No off target data available for this crispr