ID: 1066258500

View in Genome Browser
Species Human (GRCh38)
Location 10:33705268-33705290
Sequence TGGCTATTGCATTTCTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066258499_1066258500 -5 Left 1066258499 10:33705250-33705272 CCTGGACTGAAGCTCAGGTGGCT No data
Right 1066258500 10:33705268-33705290 TGGCTATTGCATTTCTAATGAGG No data
1066258491_1066258500 27 Left 1066258491 10:33705218-33705240 CCTCTAGTATTATAAGATCAGGG No data
Right 1066258500 10:33705268-33705290 TGGCTATTGCATTTCTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066258500 Original CRISPR TGGCTATTGCATTTCTAATG AGG Intergenic
No off target data available for this crispr