ID: 1066258500 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:33705268-33705290 |
Sequence | TGGCTATTGCATTTCTAATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1066258499_1066258500 | -5 | Left | 1066258499 | 10:33705250-33705272 | CCTGGACTGAAGCTCAGGTGGCT | No data | ||
Right | 1066258500 | 10:33705268-33705290 | TGGCTATTGCATTTCTAATGAGG | No data | ||||
1066258491_1066258500 | 27 | Left | 1066258491 | 10:33705218-33705240 | CCTCTAGTATTATAAGATCAGGG | No data | ||
Right | 1066258500 | 10:33705268-33705290 | TGGCTATTGCATTTCTAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1066258500 | Original CRISPR | TGGCTATTGCATTTCTAATG AGG | Intergenic | ||