ID: 1066259634

View in Genome Browser
Species Human (GRCh38)
Location 10:33716648-33716670
Sequence AAGGGGAAGAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066259634_1066259639 0 Left 1066259634 10:33716648-33716670 CCTTCCTCTTTCTTCTTCCCCTT No data
Right 1066259639 10:33716671-33716693 GTGCAATACAGATGAGCACCTGG No data
1066259634_1066259641 19 Left 1066259634 10:33716648-33716670 CCTTCCTCTTTCTTCTTCCCCTT No data
Right 1066259641 10:33716690-33716712 CTGGCCCCGCAAGACAACTGTGG No data
1066259634_1066259645 26 Left 1066259634 10:33716648-33716670 CCTTCCTCTTTCTTCTTCCCCTT No data
Right 1066259645 10:33716697-33716719 CGCAAGACAACTGTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066259634 Original CRISPR AAGGGGAAGAAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr