ID: 1066265040

View in Genome Browser
Species Human (GRCh38)
Location 10:33768631-33768653
Sequence CAGGCATGAGCTACTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267536
Summary {0: 248, 1: 8591, 2: 33471, 3: 83452, 4: 141774}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066265040_1066265049 11 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1066265040_1066265046 4 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265046 10:33768658-33768680 CCCAACACTGTGGGAGGCCAAGG 0: 64
1: 7553
2: 99953
3: 221368
4: 234060
1066265040_1066265041 -6 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265041 10:33768648-33768670 TGCCTGTAATCCCAACACTGTGG 0: 71
1: 8481
2: 114917
3: 248829
4: 238801
1066265040_1066265051 27 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265051 10:33768681-33768703 TGGACGGATTGCTTGAGCCCAGG No data
1066265040_1066265044 -2 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265044 10:33768652-33768674 TGTAATCCCAACACTGTGGGAGG 0: 222
1: 24488
2: 326278
3: 258409
4: 136093
1066265040_1066265042 -5 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265042 10:33768649-33768671 GCCTGTAATCCCAACACTGTGGG 0: 170
1: 19273
2: 250272
3: 273612
4: 170832
1066265040_1066265048 7 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265048 10:33768661-33768683 AACACTGTGGGAGGCCAAGGTGG 0: 32
1: 5002
2: 69760
3: 159007
4: 159500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066265040 Original CRISPR CAGGCATGAGCTACTGTGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr