ID: 1066265043

View in Genome Browser
Species Human (GRCh38)
Location 10:33768650-33768672
Sequence TCCCACAGTGTTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 736888
Summary {0: 220, 1: 25162, 2: 322820, 3: 254378, 4: 134308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066265043_1066265049 -8 Left 1066265043 10:33768650-33768672 CCTGTAATCCCAACACTGTGGGA 0: 220
1: 25162
2: 322820
3: 254378
4: 134308
Right 1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1066265043_1066265051 8 Left 1066265043 10:33768650-33768672 CCTGTAATCCCAACACTGTGGGA 0: 220
1: 25162
2: 322820
3: 254378
4: 134308
Right 1066265051 10:33768681-33768703 TGGACGGATTGCTTGAGCCCAGG No data
1066265043_1066265054 26 Left 1066265043 10:33768650-33768672 CCTGTAATCCCAACACTGTGGGA 0: 220
1: 25162
2: 322820
3: 254378
4: 134308
Right 1066265054 10:33768699-33768721 CCAGGAGTTCAAGACCAGCCTGG 0: 17471
1: 86795
2: 157073
3: 181920
4: 169992
1066265043_1066265055 27 Left 1066265043 10:33768650-33768672 CCTGTAATCCCAACACTGTGGGA 0: 220
1: 25162
2: 322820
3: 254378
4: 134308
Right 1066265055 10:33768700-33768722 CAGGAGTTCAAGACCAGCCTGGG 0: 17736
1: 36982
2: 56675
3: 51242
4: 33219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066265043 Original CRISPR TCCCACAGTGTTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr