ID: 1066265049

View in Genome Browser
Species Human (GRCh38)
Location 10:33768665-33768687
Sequence CTGTGGGAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066265043_1066265049 -8 Left 1066265043 10:33768650-33768672 CCTGTAATCCCAACACTGTGGGA 0: 220
1: 25162
2: 322820
3: 254378
4: 134308
Right 1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1066265040_1066265049 11 Left 1066265040 10:33768631-33768653 CCAGGCACAGTAGCTCATGCCTG 0: 248
1: 8591
2: 33471
3: 83452
4: 141774
Right 1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066265049 Original CRISPR CTGTGGGAGGCCAAGGTGGA CGG Intergenic
Too many off-targets to display for this crispr