ID: 1066270620

View in Genome Browser
Species Human (GRCh38)
Location 10:33819492-33819514
Sequence GTTTTGTCTTATTTTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066270620_1066270623 -1 Left 1066270620 10:33819492-33819514 CCAGTAAAAAAATAAGACAAAAC No data
Right 1066270623 10:33819514-33819536 CACCAGGCTGCCTGGCAAGAAGG No data
1066270620_1066270622 -9 Left 1066270620 10:33819492-33819514 CCAGTAAAAAAATAAGACAAAAC No data
Right 1066270622 10:33819506-33819528 AGACAAAACACCAGGCTGCCTGG No data
1066270620_1066270626 1 Left 1066270620 10:33819492-33819514 CCAGTAAAAAAATAAGACAAAAC No data
Right 1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG No data
1066270620_1066270624 0 Left 1066270620 10:33819492-33819514 CCAGTAAAAAAATAAGACAAAAC No data
Right 1066270624 10:33819515-33819537 ACCAGGCTGCCTGGCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066270620 Original CRISPR GTTTTGTCTTATTTTTTTAC TGG (reversed) Intergenic
No off target data available for this crispr