ID: 1066270626

View in Genome Browser
Species Human (GRCh38)
Location 10:33819516-33819538
Sequence CCAGGCTGCCTGGCAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066270619_1066270626 2 Left 1066270619 10:33819491-33819513 CCCAGTAAAAAAATAAGACAAAA No data
Right 1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG No data
1066270620_1066270626 1 Left 1066270620 10:33819492-33819514 CCAGTAAAAAAATAAGACAAAAC No data
Right 1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066270626 Original CRISPR CCAGGCTGCCTGGCAAGAAG GGG Intergenic
No off target data available for this crispr