ID: 1066271239

View in Genome Browser
Species Human (GRCh38)
Location 10:33826018-33826040
Sequence TCCAATACTCCCAGTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066271239_1066271245 20 Left 1066271239 10:33826018-33826040 CCTACCCCACTGGGAGTATTGGA No data
Right 1066271245 10:33826061-33826083 CATAGTGTTTGGCATAAAGTAGG No data
1066271239_1066271244 9 Left 1066271239 10:33826018-33826040 CCTACCCCACTGGGAGTATTGGA No data
Right 1066271244 10:33826050-33826072 CGAAGTAGAAACATAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066271239 Original CRISPR TCCAATACTCCCAGTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr