ID: 1066271245

View in Genome Browser
Species Human (GRCh38)
Location 10:33826061-33826083
Sequence CATAGTGTTTGGCATAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066271240_1066271245 16 Left 1066271240 10:33826022-33826044 CCCCACTGGGAGTATTGGACAGG No data
Right 1066271245 10:33826061-33826083 CATAGTGTTTGGCATAAAGTAGG No data
1066271239_1066271245 20 Left 1066271239 10:33826018-33826040 CCTACCCCACTGGGAGTATTGGA No data
Right 1066271245 10:33826061-33826083 CATAGTGTTTGGCATAAAGTAGG No data
1066271243_1066271245 14 Left 1066271243 10:33826024-33826046 CCACTGGGAGTATTGGACAGGTT No data
Right 1066271245 10:33826061-33826083 CATAGTGTTTGGCATAAAGTAGG No data
1066271242_1066271245 15 Left 1066271242 10:33826023-33826045 CCCACTGGGAGTATTGGACAGGT No data
Right 1066271245 10:33826061-33826083 CATAGTGTTTGGCATAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066271245 Original CRISPR CATAGTGTTTGGCATAAAGT AGG Intergenic
No off target data available for this crispr