ID: 1066277136

View in Genome Browser
Species Human (GRCh38)
Location 10:33880345-33880367
Sequence CGGGAAGCCTACAATTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066277127_1066277136 9 Left 1066277127 10:33880313-33880335 CCCAGCATCTGCTCAGCTTCTGG No data
Right 1066277136 10:33880345-33880367 CGGGAAGCCTACAATTATGGTGG No data
1066277125_1066277136 23 Left 1066277125 10:33880299-33880321 CCAGGAAGCATGGCCCCAGCATC No data
Right 1066277136 10:33880345-33880367 CGGGAAGCCTACAATTATGGTGG No data
1066277126_1066277136 10 Left 1066277126 10:33880312-33880334 CCCCAGCATCTGCTCAGCTTCTG No data
Right 1066277136 10:33880345-33880367 CGGGAAGCCTACAATTATGGTGG No data
1066277129_1066277136 8 Left 1066277129 10:33880314-33880336 CCAGCATCTGCTCAGCTTCTGGT 0: 105
1: 218
2: 408
3: 499
4: 714
Right 1066277136 10:33880345-33880367 CGGGAAGCCTACAATTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066277136 Original CRISPR CGGGAAGCCTACAATTATGG TGG Intergenic
No off target data available for this crispr