ID: 1066277547

View in Genome Browser
Species Human (GRCh38)
Location 10:33883839-33883861
Sequence CCTTAGGTGCAGAGCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066277542_1066277547 2 Left 1066277542 10:33883814-33883836 CCCGAAATGGTTTTCACTAAAAT No data
Right 1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG No data
1066277543_1066277547 1 Left 1066277543 10:33883815-33883837 CCGAAATGGTTTTCACTAAAATT No data
Right 1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066277547 Original CRISPR CCTTAGGTGCAGAGCCAAGC AGG Intergenic
No off target data available for this crispr