ID: 1066279065

View in Genome Browser
Species Human (GRCh38)
Location 10:33897428-33897450
Sequence CACAGGGAAATGCACAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066279056_1066279065 18 Left 1066279056 10:33897387-33897409 CCATGAATCAGAGCCTCTGTGAG No data
Right 1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG No data
1066279055_1066279065 30 Left 1066279055 10:33897375-33897397 CCTTGTTTCACACCATGAATCAG No data
Right 1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG No data
1066279060_1066279065 5 Left 1066279060 10:33897400-33897422 CCTCTGTGAGGGGCAAGCTGAGG No data
Right 1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066279065 Original CRISPR CACAGGGAAATGCACAGGAT AGG Intergenic
No off target data available for this crispr