ID: 1066280151

View in Genome Browser
Species Human (GRCh38)
Location 10:33909262-33909284
Sequence CGGTTTCCAGGCCATGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066280151_1066280157 16 Left 1066280151 10:33909262-33909284 CCTGCATCATGGCCTGGAAACCG 0: 1
1: 0
2: 3
3: 16
4: 110
Right 1066280157 10:33909301-33909323 AATCAATCATAGGACTCACCAGG 0: 1
1: 0
2: 1
3: 4
4: 91
1066280151_1066280155 6 Left 1066280151 10:33909262-33909284 CCTGCATCATGGCCTGGAAACCG 0: 1
1: 0
2: 3
3: 16
4: 110
Right 1066280155 10:33909291-33909313 TGATAGCCTAAATCAATCATAGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066280151 Original CRISPR CGGTTTCCAGGCCATGATGC AGG (reversed) Intergenic
902562287 1:17285029-17285051 CTGTTTCCAGGGCTTTATGCTGG - Intergenic
904369517 1:30039753-30039775 CAGGTTCCAGGCCAGGATCCAGG + Intergenic
906691523 1:47795915-47795937 CTGTTCCCAGGCCATGTGGCTGG - Intronic
909595956 1:77406310-77406332 ATGTTTCCAGGCCACGGTGCAGG + Intronic
911302298 1:96190105-96190127 CAGTTTCCAGGCTATGGTGCAGG + Intergenic
913312613 1:117516720-117516742 GAGTTTCCAGGACATGATACAGG + Intronic
915152326 1:153843962-153843984 GAGTTTCCAGGACATGATGCAGG + Intronic
915191634 1:154155526-154155548 CGGCCTCCAGGCCAGAATGCAGG + Intronic
916622470 1:166514952-166514974 CAGTTTCCAGGCCACAATGATGG - Intergenic
917584175 1:176408608-176408630 CAGTTTCCAGGCCATAGTGCAGG - Intergenic
923405205 1:233652804-233652826 CTGTTTCTAGGCCATGCTGGTGG + Intronic
923708568 1:236366679-236366701 AAGCTTCCAGGCCAAGATGCAGG - Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
1065568380 10:27041111-27041133 GAGTTTCTAGGTCATGATGCGGG + Intronic
1065900398 10:30201874-30201896 AGGTTTCCAGGAGATGATTCAGG + Intergenic
1066213598 10:33264487-33264509 GTGATTACAGGCCATGATGCCGG + Intronic
1066280151 10:33909262-33909284 CGGTTTCCAGGCCATGATGCAGG - Intergenic
1066303189 10:34115016-34115038 TGGTCTCCAGGCCATGTTGGAGG - Intronic
1066476191 10:35749545-35749567 CAGGTTCCAGGCCATGGTGCTGG - Intergenic
1072448017 10:95516177-95516199 AGGTTCCCAGGCAATGCTGCTGG - Intronic
1076248121 10:128963478-128963500 CGGTTTGCATGCCGTGATTCTGG + Intergenic
1076410035 10:130242393-130242415 CTGGTTCCAGGCCATGGTGCAGG - Intergenic
1084176549 11:67425277-67425299 CGGGTCACAGGACATGATGCAGG + Exonic
1084324942 11:68394840-68394862 AGGCTTACAGGCCATGGTGCTGG + Intronic
1089286152 11:117409394-117409416 AGGTTTCCAGGGCAAGGTGCTGG - Intronic
1089655418 11:119943668-119943690 CCCTCTCCAGGCCATGATGAAGG + Intergenic
1090751870 11:129753434-129753456 CACTTTCCAAGGCATGATGCTGG - Intergenic
1090971188 11:131644452-131644474 CGGTTTGCTGGCCATGAGACTGG - Intronic
1091199878 11:133768922-133768944 AGGTTTCCAGGGTTTGATGCAGG + Intergenic
1091433234 12:453771-453793 CGGTTTCCAGACGGGGATGCTGG - Intergenic
1092022009 12:5210700-5210722 AGGTTGTCAGGGCATGATGCTGG - Intergenic
1093794766 12:23298124-23298146 AAGTTTCCAGGCCATGGTGCAGG - Intergenic
1098445339 12:70560745-70560767 CGGTTTCAAGGCCTTGTTCCTGG - Exonic
1100983402 12:100182146-100182168 CAGTTTCCAGGCCAGGGTGCAGG + Intergenic
1101133473 12:101713498-101713520 CAGTTTCCAGGCCACAGTGCAGG - Intronic
1108505981 13:51112814-51112836 CAGCTTCCAGCCCATTATGCTGG + Intergenic
1119873449 14:78036265-78036287 TTGCTTCCAGGCCACGATGCAGG - Intergenic
1122369310 14:101220276-101220298 CAGTTTCCAGGCCATGGTGCAGG - Intergenic
1125319900 15:38474848-38474870 GAGTTTCCAGGCAATGATGCAGG - Intronic
1125448615 15:39784473-39784495 CAGTTTCCAACCCATGATTCTGG + Intergenic
1126313665 15:47344488-47344510 GAGTTTCCAGGCCACTATGCAGG + Intronic
1128541926 15:68541978-68542000 GAGTTTCCAGGCCACGGTGCAGG - Intergenic
1129747264 15:78031918-78031940 CAGTTTCCAGGCCAGGCTGCAGG + Intronic
1131076216 15:89496530-89496552 GGTGTTCCAGGCCATGCTGCAGG + Exonic
1132645738 16:998523-998545 AGGGTTCCAGGCCATGACCCTGG + Intergenic
1132889928 16:2198806-2198828 GGGCTTTCAGGCCATGATGAAGG - Intergenic
1141547516 16:84781144-84781166 CTGTCTCCAGGCCAAGAAGCAGG - Intergenic
1144777867 17:17793833-17793855 GGGTTTCCTGGGCATGGTGCCGG - Exonic
1145030721 17:19502849-19502871 AGATTTCCAGGGCATGAGGCCGG - Intronic
1152099877 17:78294769-78294791 GGGATTCCCGGCCAGGATGCAGG - Intergenic
1153820536 18:8827838-8827860 CCGTTTTCATGCCATAATGCTGG - Intronic
1155496236 18:26445612-26445634 AAGTTTCCAGGCCATGTTGCAGG - Intergenic
1161914234 19:7216725-7216747 GGGTTTCCAGGCCCAGGTGCTGG + Intronic
1161921265 19:7267974-7267996 AGGTTTCCTGTCCATGAAGCCGG - Intronic
1162560944 19:11418155-11418177 GGGTTTCCAGGGCAAGTTGCAGG - Intronic
1163555104 19:17987604-17987626 CGGTTTCCAGGCCAGGACAAAGG - Intronic
925131744 2:1498511-1498533 GGGTTTCCAGCCCAGGCTGCTGG - Intronic
925860744 2:8173051-8173073 CGTTTTCCATGCCACCATGCGGG + Intergenic
927866006 2:26588119-26588141 CGGTCTCCAGGCCCTGGGGCTGG - Intronic
929121707 2:38489198-38489220 GTGTTTCAAGGCCAGGATGCTGG - Intergenic
929494270 2:42425662-42425684 AAGTTTCCAGGTCATGATGATGG - Intergenic
930798246 2:55415496-55415518 CTCTTTCAAGGCCATAATGCTGG - Intronic
932974410 2:76580140-76580162 AGGTCTCCAGCCCATGAAGCTGG - Intergenic
935186312 2:100736709-100736731 GGGTCTCCAGGCCCTGGTGCAGG + Intergenic
937127369 2:119483076-119483098 CAGGCTCCAGGCCATGAGGCTGG + Intronic
937252593 2:120534009-120534031 CAGTTTCCCAGCTATGATGCAGG + Intergenic
941730489 2:168912075-168912097 GGGTTTCCAGAACATGGTGCAGG - Intronic
944116352 2:196191299-196191321 GAATTTCCAGGCCATGAGGCTGG + Intergenic
946404726 2:219486288-219486310 GGTTTTCCAGGCCAGCATGCAGG + Intronic
948178152 2:235960060-235960082 GACTTTCCAGGCCATGCTGCAGG - Intronic
948445946 2:238032963-238032985 CGGTTTCTAGGGGATGAGGCTGG + Intronic
1169620910 20:7505798-7505820 CTGTTTCCAGGGAATGAAGCTGG - Intergenic
1170842468 20:19935164-19935186 CGGGTTCCAGGCCATTTTCCAGG - Exonic
1175729714 20:61346100-61346122 CAGCCTCCAGCCCATGATGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1179377503 21:40863981-40864003 CGGACTCCATGCCAGGATGCAGG + Intergenic
1183979886 22:41533212-41533234 GGGTTCTCAGGCCATGCTGCAGG + Intronic
950461498 3:13124925-13124947 CGGTGGCCAGGCCAGGATGGTGG - Intergenic
955492679 3:59498959-59498981 CGGGATCCAGGCCACAATGCTGG - Intergenic
959812037 3:110630607-110630629 GAGTTTGCAGGCCATGGTGCGGG - Intergenic
965656055 3:170986293-170986315 TGCTTTCTAGGCCCTGATGCTGG + Intergenic
966640827 3:182187752-182187774 GAGTTTCTAGGCTATGATGCAGG - Intergenic
967987055 3:195103212-195103234 GGAATTCCAGGCCATGAGGCTGG + Intronic
968176376 3:196553281-196553303 AGCAATCCAGGCCATGATGCTGG - Intergenic
968596075 4:1486121-1486143 AAGTTTCCAGACCATGGTGCAGG - Intergenic
971932008 4:33096889-33096911 CGCTTTTCAGGCCATGCTGCTGG - Intergenic
973730322 4:53816604-53816626 CGGAATCCAGGCCAGGGTGCTGG + Intronic
980385180 4:132079726-132079748 TGGTTTTCAGGCCATGGAGCAGG - Intergenic
983455768 4:167962250-167962272 TGTTTTCCAGGACATGATTCTGG - Intergenic
985740992 5:1617433-1617455 CAGTTTGCAGGCCATGCAGCTGG - Intergenic
986876649 5:12119203-12119225 CAGTTCCAAGGCCATCATGCAGG - Intergenic
992360040 5:76028133-76028155 CAGTTTCCAAGCCATGATGCGGG - Intergenic
996015924 5:118534148-118534170 CAGTTGCCAGGCCCTGCTGCAGG - Intergenic
998479646 5:142452085-142452107 GAGTTTCCAGGCCATAGTGCAGG - Intergenic
1002325653 5:178403892-178403914 TGGCTTCGAGGCCATGATGGGGG - Intronic
1002592468 5:180300148-180300170 AGGTTTCCAGCCCATGATACAGG + Intergenic
1007362752 6:41370586-41370608 CGTTTTGTAGGCCATGATGAGGG - Intergenic
1007494026 6:42246862-42246884 CTGTTTCCCAGCGATGATGCTGG - Intronic
1007652742 6:43433305-43433327 CTGGTTGCTGGCCATGATGCGGG - Exonic
1015827853 6:137335062-137335084 GGGCTTCCAGGCCCTCATGCTGG + Intergenic
1019049355 6:169171183-169171205 GCGTTTCCAGGCCAGAATGCGGG + Intergenic
1019256878 7:58019-58041 CCGTTTTCCTGCCATGATGCTGG - Intergenic
1019335292 7:479922-479944 TGGTTTCCAGGCAGTGACGCAGG + Intergenic
1020182983 7:5936594-5936616 GTGTTTCCTGGCCATGATCCAGG - Intronic
1020299929 7:6788163-6788185 GTGTTTCCTGGCCATGATCCAGG + Intronic
1020372405 7:7446748-7446770 AAGTTTCCAGGTCATAATGCAGG + Intronic
1020471454 7:8540480-8540502 GGGTTTCCAGGCCACTGTGCAGG + Intronic
1022053439 7:26703058-26703080 AAGTTTCCAGCCCATGCTGCTGG + Intronic
1022517903 7:30987453-30987475 CAGTTGCCAGGCCATGCTGGCGG + Intronic
1023673215 7:42601977-42601999 GAGTTTCCAGGCCATAATGCAGG + Intergenic
1024027064 7:45420417-45420439 CAGTTTCCAGGCCATGGCACAGG + Intergenic
1027115726 7:75478363-75478385 GCGTTTCCAGGCCATGGAGCAGG + Intronic
1028877827 7:95843402-95843424 GAGTTTCCAGGCCATGGTGTAGG - Intronic
1028882952 7:95900411-95900433 TTGTATCCAGGCCATGATGGTGG - Intronic
1029721814 7:102372282-102372304 GCGTTTCCAGGCCATGGAGCAGG - Intronic
1032650961 7:133877927-133877949 GAGTTTCTGGGCCATGATGCAGG - Intronic
1035138484 7:156732315-156732337 GAGTTTCCAGGCCGTGATGCAGG + Intronic
1035482240 7:159196829-159196851 CAGTTTGCATGCCATGGTGCTGG + Intergenic
1036665896 8:10738130-10738152 AGGTCTCCAGGCCATGATGCAGG + Intronic
1038181522 8:25233139-25233161 GGGTTTCCAGGCTATTGTGCAGG - Intronic
1041438242 8:57865113-57865135 CGGTTGCCAGGGCGTGAGGCAGG - Intergenic
1042008385 8:64209339-64209361 GAGTTTCAAGGGCATGATGCTGG + Intergenic
1048525108 8:135195487-135195509 AACTGTCCAGGCCATGATGCAGG - Intergenic
1049572575 8:143376151-143376173 CCTTTGCCAGGCCCTGATGCAGG + Intronic
1049671496 8:143872104-143872126 CCTTTTCCAGGCCATGAAGAAGG - Exonic
1052048764 9:23822841-23822863 CAGCTTCAAGGGCATGATGCAGG + Intronic
1052893430 9:33724689-33724711 CACTTTCCAAGGCATGATGCTGG - Intergenic
1057686380 9:97238298-97238320 CGGGTCCCAGGCCAGGGTGCGGG + Intergenic
1185461847 X:336528-336550 CGGGTTCCAGGCCATGCAGCAGG + Intronic
1187255326 X:17636721-17636743 GCCTTTCCAGGCCATGATGATGG + Intronic