ID: 1066280389

View in Genome Browser
Species Human (GRCh38)
Location 10:33911677-33911699
Sequence ACAGATAACCTACAGAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066280389_1066280397 30 Left 1066280389 10:33911677-33911699 CCCCCCTTCTGTAGGTTATCTGT No data
Right 1066280397 10:33911730-33911752 AGAAGCCCTTTAGTTTAATTAGG 0: 29
1: 1027
2: 1753
3: 1459
4: 983

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066280389 Original CRISPR ACAGATAACCTACAGAAGGG GGG (reversed) Intergenic
No off target data available for this crispr