ID: 1066283828

View in Genome Browser
Species Human (GRCh38)
Location 10:33944580-33944602
Sequence CAGGGTTCTCAATGTAAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066283828_1066283834 -4 Left 1066283828 10:33944580-33944602 CCGACTTTACATTGAGAACCCTG No data
Right 1066283834 10:33944599-33944621 CCTGGCTGTGCTTGAGACTGGGG No data
1066283828_1066283830 -6 Left 1066283828 10:33944580-33944602 CCGACTTTACATTGAGAACCCTG No data
Right 1066283830 10:33944597-33944619 ACCCTGGCTGTGCTTGAGACTGG No data
1066283828_1066283832 -5 Left 1066283828 10:33944580-33944602 CCGACTTTACATTGAGAACCCTG No data
Right 1066283832 10:33944598-33944620 CCCTGGCTGTGCTTGAGACTGGG No data
1066283828_1066283836 13 Left 1066283828 10:33944580-33944602 CCGACTTTACATTGAGAACCCTG No data
Right 1066283836 10:33944616-33944638 CTGGGGAGAAGCGATGGCTGTGG No data
1066283828_1066283835 7 Left 1066283828 10:33944580-33944602 CCGACTTTACATTGAGAACCCTG No data
Right 1066283835 10:33944610-33944632 TTGAGACTGGGGAGAAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066283828 Original CRISPR CAGGGTTCTCAATGTAAAGT CGG (reversed) Intergenic
No off target data available for this crispr