ID: 1066287541

View in Genome Browser
Species Human (GRCh38)
Location 10:33982681-33982703
Sequence CCTGGGATTCAGGGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066287532_1066287541 13 Left 1066287532 10:33982645-33982667 CCGCTTGTTTCCTTGTCTGCTCA No data
Right 1066287541 10:33982681-33982703 CCTGGGATTCAGGGTTATATGGG No data
1066287533_1066287541 3 Left 1066287533 10:33982655-33982677 CCTTGTCTGCTCATCAGCTTCTG No data
Right 1066287541 10:33982681-33982703 CCTGGGATTCAGGGTTATATGGG No data
1066287531_1066287541 26 Left 1066287531 10:33982632-33982654 CCACACTGTTTGTCCGCTTGTTT No data
Right 1066287541 10:33982681-33982703 CCTGGGATTCAGGGTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066287541 Original CRISPR CCTGGGATTCAGGGTTATAT GGG Intergenic