ID: 1066291402

View in Genome Browser
Species Human (GRCh38)
Location 10:34017467-34017489
Sequence AGTGGAATCCAGGAACTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066291385_1066291402 26 Left 1066291385 10:34017418-34017440 CCACCTGCATGAGCCCTGCTCTT No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291397_1066291402 -8 Left 1066291397 10:34017452-34017474 CCTGAGGCTTGGAGGAGTGGAAT No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291391_1066291402 12 Left 1066291391 10:34017432-34017454 CCTGCTCTTCCTCTGGGGCACCT No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291386_1066291402 23 Left 1066291386 10:34017421-34017443 CCTGCATGAGCCCTGCTCTTCCT No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291393_1066291402 3 Left 1066291393 10:34017441-34017463 CCTCTGGGGCACCTGAGGCTTGG No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291390_1066291402 13 Left 1066291390 10:34017431-34017453 CCCTGCTCTTCCTCTGGGGCACC No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data
1066291384_1066291402 27 Left 1066291384 10:34017417-34017439 CCCACCTGCATGAGCCCTGCTCT No data
Right 1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066291402 Original CRISPR AGTGGAATCCAGGAACTAGG GGG Intergenic
No off target data available for this crispr