ID: 1066291986

View in Genome Browser
Species Human (GRCh38)
Location 10:34022697-34022719
Sequence ACCGCTTCCCACCGCATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066291986_1066291996 19 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG No data
1066291986_1066291992 0 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291992 10:34022720-34022742 TGCAGATCTGGACCTCGGTAGGG No data
1066291986_1066291990 -5 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291990 10:34022715-34022737 GCGGTTGCAGATCTGGACCTCGG No data
1066291986_1066291993 1 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291993 10:34022721-34022743 GCAGATCTGGACCTCGGTAGGGG No data
1066291986_1066291991 -1 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291991 10:34022719-34022741 TTGCAGATCTGGACCTCGGTAGG No data
1066291986_1066291994 10 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291994 10:34022730-34022752 GACCTCGGTAGGGGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066291986 Original CRISPR ACCGCTTCCCACCGCATGTG GGG (reversed) Intergenic