ID: 1066291990

View in Genome Browser
Species Human (GRCh38)
Location 10:34022715-34022737
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066291987_1066291990 -6 Left 1066291987 10:34022698-34022720 CCCACATGCGGTGGGAAGCGGTT No data
Right 1066291990 10:34022715-34022737 GCGGTTGCAGATCTGGACCTCGG No data
1066291986_1066291990 -5 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291990 10:34022715-34022737 GCGGTTGCAGATCTGGACCTCGG No data
1066291981_1066291990 10 Left 1066291981 10:34022682-34022704 CCATCTCTTCACAATCCCCACAT No data
Right 1066291990 10:34022715-34022737 GCGGTTGCAGATCTGGACCTCGG No data
1066291988_1066291990 -7 Left 1066291988 10:34022699-34022721 CCACATGCGGTGGGAAGCGGTTG No data
Right 1066291990 10:34022715-34022737 GCGGTTGCAGATCTGGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066291990 Original CRISPR GCGGTTGCAGATCTGGACCT CGG Intergenic