ID: 1066291996

View in Genome Browser
Species Human (GRCh38)
Location 10:34022739-34022761
Sequence AGGGGACAGAGAGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066291988_1066291996 17 Left 1066291988 10:34022699-34022721 CCACATGCGGTGGGAAGCGGTTG No data
Right 1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG No data
1066291987_1066291996 18 Left 1066291987 10:34022698-34022720 CCCACATGCGGTGGGAAGCGGTT No data
Right 1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG No data
1066291986_1066291996 19 Left 1066291986 10:34022697-34022719 CCCCACATGCGGTGGGAAGCGGT No data
Right 1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066291996 Original CRISPR AGGGGACAGAGAGGTCTTCC TGG Intergenic
No off target data available for this crispr