ID: 1066301562

View in Genome Browser
Species Human (GRCh38)
Location 10:34101801-34101823
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066301562_1066301564 -1 Left 1066301562 10:34101801-34101823 CCTCCAGAGTCTCTACTGAAAGC No data
Right 1066301564 10:34101823-34101845 CACCCTAGTCTCATACAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066301562 Original CRISPR GCTTTCAGTAGAGACTCTGG AGG (reversed) Intergenic
No off target data available for this crispr