ID: 1066311308

View in Genome Browser
Species Human (GRCh38)
Location 10:34199504-34199526
Sequence TCATGGCCATGGTTTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066311302_1066311308 20 Left 1066311302 10:34199461-34199483 CCCAGTGGCTGGTCAGTGAAGGC No data
Right 1066311308 10:34199504-34199526 TCATGGCCATGGTTTCATGAGGG No data
1066311300_1066311308 21 Left 1066311300 10:34199460-34199482 CCCCAGTGGCTGGTCAGTGAAGG No data
Right 1066311308 10:34199504-34199526 TCATGGCCATGGTTTCATGAGGG No data
1066311303_1066311308 19 Left 1066311303 10:34199462-34199484 CCAGTGGCTGGTCAGTGAAGGCA No data
Right 1066311308 10:34199504-34199526 TCATGGCCATGGTTTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066311308 Original CRISPR TCATGGCCATGGTTTCATGA GGG Intronic