ID: 1066319845

View in Genome Browser
Species Human (GRCh38)
Location 10:34291215-34291237
Sequence CATATGGACAAGAGTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066319845 Original CRISPR CATATGGACAAGAGTGTAGT AGG (reversed) Intronic
902136208 1:14307876-14307898 CATTTGGTCAAGATTGTATTTGG - Intergenic
906421343 1:45670619-45670641 CATATGGAAAAGAATGAAATTGG - Intronic
907496413 1:54848014-54848036 CATATAGCTAAGTGTGTAGTAGG + Intergenic
908314307 1:62917853-62917875 CATGTTGACAAGAGTTTATTAGG - Intergenic
908701188 1:66902739-66902761 CACATGGAAAAGAATGAAGTTGG - Intronic
909225185 1:73010956-73010978 CAGATGGAGAAGAGTTTAGGTGG - Intergenic
909760069 1:79275293-79275315 CATATGCAGAAGACTGAAGTTGG + Intergenic
911155459 1:94632270-94632292 CACATGGAAAAGAATGAAGTTGG - Intergenic
911505158 1:98739725-98739747 CACATGCACAAAAGTGTAGAAGG + Intronic
911809896 1:102262846-102262868 CATATTGACAACAGTACAGTTGG + Intergenic
916929017 1:169555170-169555192 AATATGGACAAGTGAGTTGTTGG - Exonic
917990247 1:180368573-180368595 CATATGCAGAAGATTGAAGTTGG - Intronic
918292327 1:183121003-183121025 GATATGAACAAGAGTGTGGGGGG - Intronic
922646902 1:227296310-227296332 CACATGGAAAAGAATGAAGTTGG + Intronic
924684258 1:246271494-246271516 CATATGCAAAAGAATGAAGTTGG - Intronic
1064573061 10:16715500-16715522 CATATGCAAAAGAATGAAGTTGG - Intronic
1066302929 10:34112782-34112804 CATATGGCCTAAAATGTAGTTGG + Intronic
1066319845 10:34291215-34291237 CATATGGACAAGAGTGTAGTAGG - Intronic
1066424443 10:35293174-35293196 CATATGCACAAAAATGAAGTTGG - Intronic
1067413686 10:46087139-46087161 CATATGCAGAAGAATGAAGTTGG - Intergenic
1068063111 10:52094802-52094824 CATGAGGCCATGAGTGTAGTAGG - Intronic
1068827905 10:61460200-61460222 AATAAGGCCAAGAGTTTAGTTGG + Intergenic
1071199393 10:83201719-83201741 CATATGCACAAGATTGAAATTGG - Intergenic
1071440942 10:85693729-85693751 CATATGCAAAAGAATGAAGTTGG + Intronic
1074430654 10:113391283-113391305 GATAAGGACCAGAGGGTAGTTGG + Intergenic
1077949259 11:6937793-6937815 CATATGCAAAAGATTGGAGTAGG + Intronic
1080750967 11:35149867-35149889 CCAATGGGCAAGAGTGTTGTAGG + Intronic
1081478945 11:43465732-43465754 CATATGCAAAAGAATGAAGTTGG + Intronic
1086256942 11:84888616-84888638 TATATGAACAAGAGTATATTAGG - Intronic
1087085754 11:94217127-94217149 CATATGCAGAAGAGTGAAATTGG - Intergenic
1088215950 11:107509694-107509716 CACATGGAAAAGAATGAAGTTGG - Intronic
1088566670 11:111179833-111179855 TATATGGACATGAGTGTATATGG + Intergenic
1092110012 12:5953275-5953297 CTTCTTGACAAGAGTGTACTTGG - Intronic
1092838335 12:12513785-12513807 CATATGGAAAAGAGAGTAAATGG - Intronic
1093422055 12:18985076-18985098 CATATGAAAAAGAATGAAGTTGG + Intergenic
1093691362 12:22113335-22113357 CATATCGACATGATTGTAGCTGG - Intronic
1094372857 12:29757109-29757131 CATATGATCAAGAATGCAGTAGG + Intronic
1094462624 12:30713632-30713654 CCTATGGAGAAGAGTTGAGTTGG - Intronic
1094777615 12:33749289-33749311 CAGATGGATAAGAAAGTAGTGGG + Intergenic
1095680726 12:44972341-44972363 AATATGGACAAAAGTGTTGAAGG - Intergenic
1101265663 12:103083626-103083648 TAGATGGACAAAATTGTAGTTGG + Intergenic
1106799040 13:33237102-33237124 GACATGGACAAGATTGTAGAGGG - Intronic
1107257667 13:38448076-38448098 CATATGCAAAAGAATGAAGTTGG - Intergenic
1107318078 13:39155705-39155727 GATATGGACTAGAGAATAGTAGG - Intergenic
1108580022 13:51820054-51820076 CATATGGACATGTGTGTGTTTGG - Intergenic
1110977174 13:81853618-81853640 CATATGCAAAAGAGTAAAGTTGG + Intergenic
1111193507 13:84840482-84840504 CTTATGGTCAAGAGTGAAGTTGG + Intergenic
1111766502 13:92537217-92537239 CAGATTTACAATAGTGTAGTTGG + Intronic
1112073872 13:95886640-95886662 TATATGGACAAGAGTCTTGAGGG + Intronic
1112810933 13:103217737-103217759 CTTAAGGAAAAGAGTGTAGTAGG + Intergenic
1114165532 14:20214637-20214659 CATATGTACAAGAATGAAATTGG - Intergenic
1114634308 14:24178755-24178777 GCTGTGGACAAGAGGGTAGTAGG - Exonic
1115577030 14:34721817-34721839 CATATGCAAAAGAATGAAGTTGG - Intergenic
1115830745 14:37338058-37338080 CATATGCAAAAGACTGAAGTTGG - Intronic
1115858944 14:37662604-37662626 CATATGGAGAAGACTGAAGCTGG - Intronic
1116205128 14:41855524-41855546 CAGTTGGACAAGAATGTCGTAGG + Intronic
1116343787 14:43761481-43761503 CATATGCAAAAGATTGAAGTTGG + Intergenic
1116909981 14:50451282-50451304 TACATGAAGAAGAGTGTAGTGGG + Intronic
1117210983 14:53499502-53499524 CACATGGAAAAGAATGAAGTTGG + Intergenic
1118024954 14:61759589-61759611 CATATGGAAAAAAGTGAAATAGG + Intergenic
1120016628 14:79481442-79481464 CATATAGCTAGGAGTGTAGTAGG - Intronic
1120022293 14:79544369-79544391 CATCTAAACAAGAGTGCAGTGGG + Intronic
1120423963 14:84323493-84323515 CACATGGGTAAGAGGGTAGTTGG - Intergenic
1120746139 14:88153584-88153606 CACCTGGACAATAGGGTAGTAGG - Intergenic
1120920865 14:89754381-89754403 CATATGCAGAAGATTGAAGTTGG + Intergenic
1122447199 14:101778599-101778621 CATATGGACAAGAATAAAGGTGG - Intronic
1124459560 15:29876842-29876864 GATATGGTCAAGAGTGTGCTAGG - Intronic
1125243690 15:37607895-37607917 AATATGGACAAGTGTTTATTTGG - Intergenic
1126493881 15:49269126-49269148 CTTATGGATTAGAGTGTACTTGG + Intronic
1126724571 15:51618806-51618828 CAGATGGAAGAGATTGTAGTTGG - Intronic
1127404379 15:58625963-58625985 CATATGGAGAACAGGGTAGCAGG + Intronic
1128627098 15:69220955-69220977 CATATGCAAAAGAGTGAAGCTGG - Intronic
1129973374 15:79800175-79800197 CATATGCAAAAGAGTGAAGCTGG - Intergenic
1129988715 15:79942313-79942335 CACATGCACAAGAAGGTAGTTGG + Intergenic
1130245936 15:82248751-82248773 CATATGGAAAACACTGCAGTGGG - Intronic
1130833418 15:87626277-87626299 TATATGGGCAAGACTGTAATGGG - Intergenic
1132034345 15:98468682-98468704 CATATGCAAAAGAATGAAGTTGG + Intronic
1138620448 16:58206796-58206818 CACCTAGACAAGAGTGTAGATGG - Intergenic
1144799599 17:17916466-17916488 CACATGCAAAAGAGTGAAGTCGG - Intronic
1145849613 17:28080011-28080033 CACATGGAAAAGAATGAAGTTGG - Intronic
1146117322 17:30152608-30152630 CATATGCAAAAGAATGAAGTTGG - Intronic
1149006950 17:51815930-51815952 AATAACTACAAGAGTGTAGTTGG - Intronic
1153113073 18:1617575-1617597 CACATGCAAAAGAGTGAAGTTGG + Intergenic
1153736524 18:8075090-8075112 CACATGCACAAGAATGAAGTTGG - Intronic
1153935414 18:9915668-9915690 CCTATGGAAAACAATGTAGTTGG - Intronic
1157253252 18:46115110-46115132 CATATGCTCAAGAATGAAGTTGG + Intronic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1158060725 18:53337800-53337822 CATATGGATAAAAGTGGAGGGGG + Intronic
1164713536 19:30375638-30375660 CATATGGGCATGAGTGTACATGG + Intronic
1168001801 19:53452440-53452462 CACCTGGACTGGAGTGTAGTGGG - Intronic
1168367208 19:55798806-55798828 TACATGGAAAAGAGTGTAGAAGG - Intronic
925652914 2:6111148-6111170 AAAATGGACAAGAGCATAGTGGG + Intergenic
925858249 2:8151019-8151041 CCTATGGAAAAGAGAGTTGTGGG + Intergenic
925986586 2:9220851-9220873 CATATGCAAAAGAATGAAGTTGG - Intronic
926587114 2:14699056-14699078 CATAAGGACAAGAGAGTAAGAGG - Intergenic
928884059 2:36128597-36128619 CATATGGCCAAGTCTGTAGGTGG - Intergenic
929994292 2:46815761-46815783 CAAATAGACAAGTGTTTAGTTGG + Intergenic
932064692 2:68542086-68542108 CACATGCAAAAGAGTGAAGTTGG + Intronic
933681279 2:85103457-85103479 CATATGCAAAAGAATGAAGTTGG + Intergenic
934911649 2:98262464-98262486 CATATGCAAAAGAATGAAGTTGG - Intronic
936893385 2:117398255-117398277 CATATGCAGAAGATTGGAGTTGG + Intergenic
937484915 2:122305484-122305506 CATATGCAGAAGACTGAAGTTGG + Intergenic
937864615 2:126739773-126739795 CACATGGCCAAGCCTGTAGTCGG + Intergenic
938168251 2:129051482-129051504 CACATGCACAAGAATGAAGTTGG - Intergenic
938764232 2:134449795-134449817 GATTTGGACAGGAGTGAAGTCGG + Exonic
943770892 2:191715420-191715442 CATATGGAATGGTGTGTAGTAGG + Intergenic
944980755 2:205117311-205117333 CATAGGCACAAGTGTGCAGTGGG - Intronic
945514216 2:210742723-210742745 CATATGCAAAAGAATGAAGTTGG - Intergenic
945814592 2:214588897-214588919 AATATAGACAACAGTGTAATGGG + Intergenic
947438623 2:230096372-230096394 CATATGCAGAAGAATGAAGTTGG - Intergenic
948780196 2:240316242-240316264 CATATGCAAAAGAATGAAGTTGG + Intergenic
1170216495 20:13897203-13897225 CACATGCAAAAGAATGTAGTTGG + Intronic
1170815700 20:19712424-19712446 CATAGGGACAATAGTGAACTTGG + Intronic
1171049891 20:21847469-21847491 CAGATGGAAAAGAGTGAAGTTGG + Intergenic
1171778837 20:29398975-29398997 CATATGCAGAAGATTGAAGTTGG + Intergenic
1171820621 20:29834281-29834303 CATATGCAGAAGATTGAAGTTGG + Intergenic
1171822910 20:29871429-29871451 CATATACAGAAGAGTGAAGTTGG + Intergenic
1175653011 20:60744849-60744871 CATGTGGCCAGGTGTGTAGTAGG + Intergenic
1178118619 21:29443784-29443806 CAGATGGCCAAGATTGTAGCTGG + Intronic
1180324650 22:11359230-11359252 CATATGCAGAAGATTGAAGTTGG + Intergenic
1183917377 22:41132688-41132710 CATATAGAAATGAGTGTAGTTGG + Intronic
1184656411 22:45944177-45944199 GAGACGGACAAGAGTGGAGTGGG - Intronic
949989580 3:9567967-9567989 CATTTGGAAAAGAATGAAGTTGG - Intergenic
950383633 3:12638611-12638633 CAGATGAACAAGAATGTATTTGG - Intronic
951557756 3:23937907-23937929 CATTTGGAGAAGAATCTAGTAGG - Intronic
952588022 3:34916478-34916500 CATAGAGCCAAGGGTGTAGTAGG - Intergenic
952619745 3:35323546-35323568 CATATGCAGAAGATTGAAGTTGG - Intergenic
952709710 3:36417144-36417166 TGCATGGACAAGAGTGTAGGAGG + Intronic
953764366 3:45724885-45724907 CATATGCAAAAGAATGAAGTTGG - Intronic
955778671 3:62461136-62461158 CATCTGCAGAAGAGTGTTGTTGG + Intronic
957086304 3:75681579-75681601 CATATGCAGAAGATTGAAGTTGG - Intergenic
959865469 3:111264542-111264564 CACATGGAAAAGAATGAAGTAGG + Intronic
960077826 3:113508077-113508099 CATATGAAAAAGAATGAAGTTGG + Intronic
960646899 3:119895606-119895628 CATATGCAAAAGAATGAAGTTGG - Intronic
960762390 3:121087582-121087604 CTTATAGACAAGCGTATAGTTGG + Intronic
962062523 3:131945347-131945369 CCTATTGGCAAAAGTGTAGTTGG + Intronic
962359035 3:134720674-134720696 CATATGCAAAAGAGTGAAGTTGG - Intronic
962984902 3:140526880-140526902 CATATGGAAAAGAATGAAGCTGG + Intronic
963095906 3:141539897-141539919 CATATGGCCAAGAGTCTTGATGG - Intronic
963546746 3:146669222-146669244 CATATGCAGAAGAGTGAAATTGG - Intergenic
963577074 3:147074490-147074512 CATATGCAAAAGAATGAAGTTGG + Intergenic
963791611 3:149588623-149588645 CATATGAACAAGGGGGAAGTAGG + Intronic
966583257 3:181592096-181592118 CATATGTACAAGATTGAAGCTGG - Intergenic
973144498 4:46807702-46807724 CATATGCAAAAGAATGAAGTAGG - Intronic
973660555 4:53101540-53101562 CAAATGGAAAAGAATGCAGTTGG + Intronic
974559908 4:63504273-63504295 CATATGCAGAAGATTGAAGTTGG - Intergenic
975059883 4:69984695-69984717 CAGAAGGACAGGAGTGTAATGGG + Intergenic
975265340 4:72358322-72358344 TATATGCACAAAAGTGTAGCAGG - Intronic
975904358 4:79191878-79191900 CATATGCAGAAGATTGAAGTTGG - Intergenic
976066563 4:81194280-81194302 TACAGGGACAAGAGTGGAGTTGG + Intronic
977590323 4:98818908-98818930 CATATGCAAAAGAATGAAGTTGG + Intergenic
978060792 4:104335333-104335355 CATATGGAGAAGATTGAAATTGG + Intergenic
978601945 4:110437779-110437801 GAAATAGAAAAGAGTGTAGTGGG + Intronic
979372305 4:119903815-119903837 CACATGCAAAAGAGTGAAGTTGG + Intergenic
981868888 4:149462399-149462421 CACATGGACAAGAGGACAGTGGG - Intergenic
984394172 4:179172548-179172570 CATATGCAAAAGAATGAAGTTGG - Intergenic
984806382 4:183755528-183755550 CATATCGCCAGGAGTGTAGTGGG + Intergenic
985138677 4:186815721-186815743 CATATGCAAAAGAATGAAGTTGG - Intergenic
985443694 4:190006246-190006268 CATATGCAGAAGATTGAAGTTGG + Intergenic
987956050 5:24741691-24741713 CATATGCAAAAGAATGAAGTTGG - Intergenic
988583121 5:32485644-32485666 CATATGCAAAAGATTGAAGTTGG - Intergenic
989235813 5:39147428-39147450 CATATGTACAAAAGTTTAGCTGG - Intronic
991232777 5:64355839-64355861 CATATGCAAAAGAATGAAGTTGG + Intronic
991268058 5:64746163-64746185 CACATGGGAAAGAATGTAGTTGG + Intronic
993696608 5:91069086-91069108 CATATGGAAAAGATTGAAATTGG + Intronic
996788049 5:127262307-127262329 CATATGCAAAAGAATGAAGTTGG - Intergenic
997719767 5:136068685-136068707 CACATGGAAAAGAATGAAGTTGG - Intergenic
1001490803 5:172153800-172153822 CAAATGGGCAAAAGTGTAGAAGG - Intronic
1001917316 5:175572405-175572427 CACATGGAAAAGAATGAAGTTGG + Intergenic
1003233908 6:4279257-4279279 CACATGGAAAAGAATGAAGTTGG - Intergenic
1004367696 6:15025897-15025919 CATAAGGACAAGAGAGAAGCAGG + Intergenic
1004948589 6:20643191-20643213 CAGATGGACAAGAGTGGACCAGG - Intronic
1005196786 6:23296480-23296502 CATATACAGAAGAGGGTAGTAGG + Intergenic
1009553354 6:65129109-65129131 CATATGCAGAAGAGTGAAGTTGG + Intronic
1009877872 6:69528806-69528828 CGTAAGAACAAGAGTGTAGATGG - Intergenic
1011106970 6:83792880-83792902 CATATGCAGAAGACTGAAGTTGG + Intergenic
1012363686 6:98413782-98413804 CATATGAACAAAAGTGAAATTGG + Intergenic
1012981230 6:105832159-105832181 CATCTGGACAAGTCTGTGGTTGG - Intergenic
1015906859 6:138126229-138126251 CATATGCAGAAGAGTGAAGCTGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1019376437 7:695078-695100 CAAATGAACAAAAATGTAGTCGG + Intronic
1020860613 7:13488381-13488403 CATATGGAGAAGATTGAAGCTGG + Intergenic
1020862706 7:13514968-13514990 CATATGCAGAAGATTGAAGTTGG + Intergenic
1020995367 7:15256776-15256798 CATATAGCCAGGTGTGTAGTAGG + Intronic
1024012964 7:45286115-45286137 CACATGGAAAAGACTGTTGTAGG + Intergenic
1024087301 7:45905159-45905181 CATAGGCAAAAGAGTGAAGTTGG + Intergenic
1024847753 7:53668614-53668636 CACATGTACAAGAGTGAAGTTGG - Intergenic
1025621856 7:63180274-63180296 GAAATAGAAAAGAGTGTAGTGGG + Intergenic
1025959669 7:66208980-66209002 CATATGGAAAAGTGTGTCTTAGG + Intronic
1027270453 7:76515776-76515798 CATATGCACAAGAGGGTTGGAGG - Intronic
1029214941 7:98941089-98941111 CATATGCAAAAGAATGAAGTTGG - Intronic
1029932679 7:104389810-104389832 CATATGTAAAAGAATGAAGTTGG + Intronic
1030691067 7:112534303-112534325 CATATGCAAAAGAATGAAGTTGG - Intergenic
1031651542 7:124297110-124297132 CATATGGACAAGAGTTAAATTGG - Intergenic
1033957398 7:146868216-146868238 CATATGGAAAAGATTGAAGCTGG - Intronic
1034052118 7:147994820-147994842 CTTCTGGACACCAGTGTAGTTGG + Intronic
1034582391 7:152056539-152056561 CACATGGACATGTGTGTAGAAGG - Intronic
1038032705 8:23657831-23657853 CATGTGTAAAAGAGTGGAGTTGG - Intergenic
1038829256 8:31038771-31038793 CATATGGAAAAGAGTGAAGTTGG - Intronic
1041084800 8:54246872-54246894 CATGTGGAAAAGAATGAAGTTGG + Intergenic
1042581631 8:70285588-70285610 CAAATGTACAATAATGTAGTAGG - Intronic
1044080326 8:87874669-87874691 TATTTTGACAAGAGTGTAATTGG - Intergenic
1044214103 8:89587060-89587082 CATATGCAGAAGATTGAAGTTGG - Intergenic
1044783869 8:95773957-95773979 CATATAGAAAAGAGTGGAGCTGG + Intergenic
1045364630 8:101464353-101464375 CACATGCAAAAGAGTGAAGTTGG + Intergenic
1045518551 8:102882612-102882634 CATATGCAAAAGAATGAAGTTGG + Intronic
1046785738 8:118264551-118264573 CATCTGCACAAGAGTGAAATGGG + Intronic
1048236070 8:132692058-132692080 TATATGAAAAAGAGAGTAGTAGG + Intronic
1048634181 8:136278095-136278117 CAAATGAACAAGAGTGTAAGGGG - Intergenic
1048684972 8:136894613-136894635 TGAATGGAGAAGAGTGTAGTGGG - Intergenic
1050226263 9:3459767-3459789 AAAATGGATAAGAATGTAGTAGG - Intronic
1050342329 9:4653303-4653325 CATATGCAAAAGAATGAAGTTGG + Intronic
1051994082 9:23192986-23193008 CATATGCAGAAGAGTGAAATTGG + Intergenic
1053749772 9:41240709-41240731 CATATGCAGAAGATTGAAGTTGG - Intergenic
1054255276 9:62805045-62805067 CATATGCAGAAGATTGAAGTTGG - Intergenic
1054336033 9:63810562-63810584 CATATGCAGAAGATTGAAGTTGG + Intergenic
1055083041 9:72286085-72286107 CATATGCAGAAGAGTGAAGTTGG - Intergenic
1055996409 9:82164938-82164960 CATATGCACAAGAGTGAAACTGG + Intergenic
1056361863 9:85866489-85866511 CATATGCAGAAGAGTGAAATTGG + Intergenic
1056806401 9:89732280-89732302 CATTTGGATAAGATTTTAGTTGG + Intergenic
1057530865 9:95844733-95844755 CATATGCAAAAGAATGAAGTTGG - Intergenic
1057897411 9:98920596-98920618 CATATGCAAAAGAATGAAGTTGG + Intergenic
1060623245 9:125086709-125086731 CATAGGGGCAAGAGTGGCGTGGG + Intronic
1061932280 9:133839261-133839283 CAGATGGATGAGAGAGTAGTTGG + Intronic
1203372297 Un_KI270442v1:319789-319811 CATATGCAGAAGATTGAAGTTGG + Intergenic
1187360044 X:18617467-18617489 CATATGGGTAAGGGTGTGGTTGG - Intronic
1187413038 X:19067441-19067463 CACATGCACGAGAGTGAAGTTGG + Intronic
1187740209 X:22347639-22347661 CATATGCAAAAGAATGAAGTTGG - Intergenic
1191001062 X:55660082-55660104 AATAGGGCCAAGGGTGTAGTGGG + Intergenic
1193017602 X:76753334-76753356 CATTTGGTCTAAAGTGTAGTTGG - Intergenic
1193708217 X:84848990-84849012 CATATGCAGAAGAATGAAGTTGG + Intergenic
1193711015 X:84880024-84880046 CATATGCAGAAGAATGAAGTTGG - Intergenic
1193932309 X:87568792-87568814 CACATGCACAAGAATGAAGTTGG + Intronic
1194209427 X:91052690-91052712 CACATGCAAAAGAGTGAAGTTGG + Intergenic
1199121989 X:144065727-144065749 CACATGTAGAAGAGTGAAGTTGG + Intergenic