ID: 1066333612

View in Genome Browser
Species Human (GRCh38)
Location 10:34452765-34452787
Sequence TGATCTCAGTTTCCAACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066333610_1066333612 29 Left 1066333610 10:34452713-34452735 CCTGACAACTTTTAAGCACAAGT 0: 1
1: 1
2: 0
3: 8
4: 118
Right 1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG No data
1066333609_1066333612 30 Left 1066333609 10:34452712-34452734 CCCTGACAACTTTTAAGCACAAG 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066333612 Original CRISPR TGATCTCAGTTTCCAACAAG AGG Intronic
No off target data available for this crispr