ID: 1066337638

View in Genome Browser
Species Human (GRCh38)
Location 10:34495351-34495373
Sequence GTTCATCAGAGTCCAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066337634_1066337638 30 Left 1066337634 10:34495298-34495320 CCAACACACAGTCACAGTGCCCA 0: 1
1: 0
2: 2
3: 18
4: 288
Right 1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG No data
1066337637_1066337638 10 Left 1066337637 10:34495318-34495340 CCACAGAAACGTCAGGCTACAGT 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG No data
1066337636_1066337638 11 Left 1066337636 10:34495317-34495339 CCCACAGAAACGTCAGGCTACAG No data
Right 1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066337638 Original CRISPR GTTCATCAGAGTCCAAATAA AGG Intronic
No off target data available for this crispr