ID: 1066344998

View in Genome Browser
Species Human (GRCh38)
Location 10:34575929-34575951
Sequence GTATTTGAGCTCTTCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066344996_1066344998 16 Left 1066344996 10:34575890-34575912 CCGTCTCAAAAAAAAAGAAAAAG 0: 264
1: 8684
2: 98755
3: 71242
4: 99836
Right 1066344998 10:34575929-34575951 GTATTTGAGCTCTTCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066344998 Original CRISPR GTATTTGAGCTCTTCTCTGT AGG Intronic
No off target data available for this crispr