ID: 1066348954

View in Genome Browser
Species Human (GRCh38)
Location 10:34618895-34618917
Sequence GTCTCCTTTCTGGTTTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066348950_1066348954 -7 Left 1066348950 10:34618879-34618901 CCACAATATGATCCCAGTCTCCT 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1066348954 10:34618895-34618917 GTCTCCTTTCTGGTTTCACTTGG No data
1066348948_1066348954 23 Left 1066348948 10:34618849-34618871 CCTCAACACTAAGGTAATATTTA 0: 1
1: 0
2: 1
3: 40
4: 938
Right 1066348954 10:34618895-34618917 GTCTCCTTTCTGGTTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066348954 Original CRISPR GTCTCCTTTCTGGTTTCACT TGG Intronic
No off target data available for this crispr