ID: 1066350027

View in Genome Browser
Species Human (GRCh38)
Location 10:34628682-34628704
Sequence CCCATCAGTGCTGCGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066350027_1066350034 19 Left 1066350027 10:34628682-34628704 CCACACTGCGCAGCACTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1066350034 10:34628724-34628746 GAGGCAGATACACCTGTGTTTGG No data
1066350027_1066350032 0 Left 1066350027 10:34628682-34628704 CCACACTGCGCAGCACTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1066350032 10:34628705-34628727 CCTGACCAGGATGGACAGAGAGG No data
1066350027_1066350030 -9 Left 1066350027 10:34628682-34628704 CCACACTGCGCAGCACTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1066350030 10:34628696-34628718 ACTGATGGGCCTGACCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066350027 Original CRISPR CCCATCAGTGCTGCGCAGTG TGG (reversed) Intronic
900513876 1:3072353-3072375 CCCATCAGAGCTGCTCCTTGAGG + Intronic
900783594 1:4633666-4633688 GACCTCAGTGCTGAGCAGTGCGG + Intergenic
903335045 1:22619055-22619077 CCCATCACTTCCGGGCAGTGTGG + Intergenic
907502045 1:54887718-54887740 CACAGCAGTCCTGGGCAGTGGGG + Intergenic
913175485 1:116269114-116269136 CCCACCAGAGCCGCACAGTGTGG + Intergenic
914095700 1:144543050-144543072 CCCTTAGGTCCTGCGCAGTGGGG - Intergenic
915629252 1:157138739-157138761 CCCGCCAGTCCTGCGCCGTGAGG + Intergenic
916939030 1:169661323-169661345 CCCACCAGCCCTGGGCAGTGAGG + Intergenic
918084111 1:181230618-181230640 CCCATCATTGCTGCTGGGTGGGG + Intergenic
922926065 1:229347535-229347557 CCCATGAGTGCTGTCCAGTTTGG + Intergenic
922962593 1:229661540-229661562 CCCTTCAGAGCTGTGCAGGGAGG - Intergenic
924055247 1:240118524-240118546 CCTATCAGGACTGCACAGTGAGG + Intronic
924910196 1:248502387-248502409 CCCACCGGTGCTTCACAGTGTGG + Intergenic
924913905 1:248545651-248545673 CCCACCGGTGCTTCACAGTGTGG - Intergenic
1062790126 10:298386-298408 ACCATCAGTGATGAGCAGGGGGG - Intronic
1066350027 10:34628682-34628704 CCCATCAGTGCTGCGCAGTGTGG - Intronic
1070546337 10:77455786-77455808 CCCATCACTGCTGCACTGGGTGG + Intronic
1070913753 10:80139505-80139527 CCCAGCAGTGCTCCACAGTCTGG - Intronic
1073479970 10:103780204-103780226 CCCATCAGGGTTGCACACTGGGG - Intronic
1073649181 10:105340758-105340780 CCAATCAATGCTGCGGAGAGAGG - Intergenic
1076266646 10:129113968-129113990 CCCCCCATTGCTGGGCAGTGGGG + Intergenic
1076512795 10:131024458-131024480 CCCAACAGTGTTGGGCGGTGGGG - Intergenic
1076736983 10:132463306-132463328 GCCATCAGAGCAGCGCAGGGCGG + Intergenic
1077071121 11:673706-673728 CCCATCTGTGCTGAGCAGACAGG + Intronic
1081524642 11:43918104-43918126 CCCATCAGTTCTGCCCAGAATGG + Intronic
1083205304 11:61145290-61145312 CCCATCAGAGGGGTGCAGTGAGG + Intronic
1083487611 11:62993382-62993404 CCCATCAGTGCTCCTCCCTGGGG - Intronic
1083724875 11:64622875-64622897 GCCGTCCGTGCTGCTCAGTGCGG - Exonic
1084000609 11:66293511-66293533 CCCATCTGTGCTGAGCAAGGGGG - Intronic
1084949332 11:72656113-72656135 CCCAACCATGCTGCACAGTGGGG + Intronic
1086866829 11:91989808-91989830 CCCATCAGTGTTTCTCAGTGAGG - Intergenic
1089641892 11:119853281-119853303 CCCCTCAGAGCAGCTCAGTGGGG + Intergenic
1097236527 12:57543920-57543942 CCAATCAGAGCTGCACAGTCAGG + Intronic
1100061350 12:90579853-90579875 CCAAACTGTGCTGCACAGTGGGG - Intergenic
1113950306 13:114067763-114067785 CCCCTCAGGGCTGCCAAGTGAGG + Intronic
1117449809 14:55839615-55839637 CCCACCAGCCCTGGGCAGTGAGG + Intergenic
1122720725 14:103720791-103720813 CCCATCACTCCTCCACAGTGCGG - Intronic
1122726569 14:103758728-103758750 CCCTTCAGTTCTGAGCAGGGAGG + Intronic
1128250206 15:66158602-66158624 CCCATCAGTGGGGCTGAGTGGGG - Intronic
1131385569 15:92003887-92003909 CCCATCAGCACTGCGCAGCTGGG + Intronic
1131865672 15:96706853-96706875 CCCACCAGAGCTGCACACTGTGG - Intergenic
1132525406 16:411715-411737 CACATGGGTGCTGCCCAGTGGGG + Intronic
1137802994 16:51278038-51278060 CTGATCAGTGCTCAGCAGTGAGG - Intergenic
1142189871 16:88712845-88712867 CCCAACTGTTCTGCTCAGTGAGG + Exonic
1142221124 16:88855790-88855812 CCCACCTGTGCTGACCAGTGGGG - Intronic
1148649425 17:49238953-49238975 CCCATTATTGCTGCTAAGTGAGG - Intergenic
1151113563 17:71706695-71706717 CCCAACAGTGCTGTGAGGTGGGG + Intergenic
1151350640 17:73529968-73529990 CCCATTCCTGCTGCCCAGTGGGG + Intronic
1151878255 17:76879518-76879540 CCCACCAGGGCTGCCCAGTGAGG + Intronic
1152824554 17:82456430-82456452 CACATGAGTCCTGAGCAGTGAGG - Intergenic
1157441711 18:47716784-47716806 CCCATCTCGGCTGCTCAGTGAGG - Intergenic
1157914756 18:51654436-51654458 CCCCTCAGTGAGGCTCAGTGCGG - Intergenic
1158676305 18:59522240-59522262 CCCATCAATGATGTGAAGTGAGG - Intronic
1158833743 18:61308270-61308292 GCAATCATTGCTGGGCAGTGAGG + Intergenic
1160042428 18:75358036-75358058 ATCATCTGTGCTGCCCAGTGTGG - Intergenic
1160374810 18:78403603-78403625 CCCAGCAGTGCTGCTCAGGATGG + Intergenic
1161707078 19:5827265-5827287 CCCCCCAGTGCTGCCCAGAGAGG + Intronic
1163242382 19:16072136-16072158 CCCTTCAGTGGTAGGCAGTGAGG - Intronic
1164901974 19:31935430-31935452 CCCACAAGTGCTGGGCACTGTGG - Intergenic
925295030 2:2770453-2770475 CGCATGGGTGCTGTGCAGTGAGG - Intergenic
925596546 2:5561188-5561210 CCCACCAGTGCTCCACAGAGTGG + Intergenic
925836719 2:7953448-7953470 CCCAGCAGCGCTAGGCAGTGAGG + Intergenic
929807920 2:45163373-45163395 CCCAACAGTGCTGGGCTGTAGGG - Intergenic
931177087 2:59865099-59865121 CCTATCAGAGCTGAGCAGAGAGG - Intergenic
931213349 2:60218300-60218322 CCTATCAGGGCTGGGCACTGTGG - Intergenic
932219098 2:69986521-69986543 CCCAGCAGTGCTGAGCAGGAGGG + Intergenic
932313380 2:70762500-70762522 CCCATCAGTCCTGGGCAATCAGG + Intronic
933271350 2:80236412-80236434 CAAATCAGTGCAGTGCAGTGAGG + Intronic
936946296 2:117934010-117934032 CCCCTCAGTGCTGACCAGTGTGG - Intronic
937290905 2:120781205-120781227 GCCCTCAGTGCTGGGCAGTGAGG - Intronic
938265864 2:129927853-129927875 CCCAGCAGTGCTCCACAGTCTGG + Intergenic
940176049 2:150878622-150878644 CACATGAGTCCTGAGCAGTGAGG + Intergenic
941919613 2:170836700-170836722 CCCATCAGTGTGACCCAGTGGGG + Intronic
942848909 2:180459401-180459423 ACCATCAGTGCTCTGCAATGAGG + Intergenic
946328635 2:218997629-218997651 CCCAGCAGTACTGAGCAGTCAGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1175574273 20:60048985-60049007 CACATCAGTCCTGGGTAGTGTGG + Intergenic
1176443877 21:6801288-6801310 ACCTCCAGTGCTCCGCAGTGCGG - Intergenic
953114488 3:39978389-39978411 GCCATCTGTGCTGTGGAGTGTGG + Intronic
953666855 3:44931546-44931568 TCCACCAGGGCTGAGCAGTGAGG + Intronic
956172462 3:66443589-66443611 CCCATCAGTGACGGGCAGTGAGG + Intronic
957446126 3:80314600-80314622 CCCACCGGTACTGGGCAGTGAGG + Intergenic
957681309 3:83439790-83439812 GCCATCAGATCTGCCCAGTGTGG + Intergenic
957682639 3:83457412-83457434 CCCATCAGAATTGCCCAGTGTGG - Intergenic
960585012 3:119312762-119312784 TCTATCTGTGCTGCCCAGTGTGG + Intronic
962139125 3:132769721-132769743 AACATCAGGGCTGCCCAGTGTGG + Intergenic
962259674 3:133894924-133894946 CCCTCCAGTGCAGCGGAGTGAGG + Intronic
963080301 3:141385823-141385845 CCCATCAATCTTGAGCAGTGGGG + Intronic
968117963 3:196104069-196104091 ACCATCAGGGCCGGGCAGTGTGG - Intergenic
968808293 4:2788749-2788771 CCCTCCAGTGCTGGGCTGTGTGG + Intergenic
968915429 4:3495156-3495178 ACCCTCAGTGCAGCCCAGTGAGG - Intronic
969723854 4:8907780-8907802 CCCAGCAGAGCTGCGGATTGTGG + Intergenic
973981088 4:56308877-56308899 CTCATAAGTGCTGGGCACTGTGG + Intronic
985196626 4:187437220-187437242 CCCATGACTGGTGGGCAGTGAGG - Intergenic
985973173 5:3393304-3393326 CTCACCAGTGCGGTGCAGTGAGG + Intergenic
986170869 5:5313553-5313575 GCCCTCAGTGCTGGGCAGTGTGG + Intronic
989365629 5:40652499-40652521 CCCCTCAGTTCTGGCCAGTGGGG - Intergenic
990608102 5:57430122-57430144 TGCATCAGTGCAGCCCAGTGAGG - Intergenic
997354627 5:133254441-133254463 CCCATCAGGCCTGGGCCGTGTGG + Intronic
997372994 5:133373969-133373991 CACATCTGTGCTGCTGAGTGTGG - Intronic
997825697 5:137105103-137105125 CCCCTCAGTGCTGCACAGATGGG + Intronic
999381207 5:151122827-151122849 CCCATCGGTTCTGCACAGTTGGG - Intronic
1001593444 5:172882130-172882152 CCCACCACTGCTGCCCAGCGTGG + Intronic
1002058955 5:176615123-176615145 ACCATCAGTGCAGCACTGTGAGG - Intergenic
1006087117 6:31603916-31603938 CCCACCACTGCTGGGCATTGAGG + Intergenic
1011129346 6:84037735-84037757 CCCACCAGCCCTGGGCAGTGAGG - Intronic
1015690249 6:135914369-135914391 CACGTCAGTGCTGGGAAGTGGGG - Intronic
1020414815 7:7933993-7934015 CCCATTACTGCTGGGCAGGGCGG + Intronic
1021969885 7:25954970-25954992 ACCATCAGTGATAGGCAGTGTGG - Intergenic
1022203332 7:28139025-28139047 ATCTTCAGTGCTGGGCAGTGGGG - Intronic
1022228121 7:28384243-28384265 ACCAGCAGTACTGCGCACTGGGG - Intronic
1023253768 7:38292250-38292272 CCCATGAGTGCTGGGCAGATCGG + Intergenic
1024409969 7:49029069-49029091 CCCACCACTGCTGCTCTGTGTGG - Intergenic
1024629214 7:51233646-51233668 CCAATCAGTTATGCGCTGTGTGG - Intronic
1027921422 7:84400019-84400041 CCCATCAGGGCTGGGCATTTAGG + Intronic
1028175695 7:87655796-87655818 TCCAACAGTGCTGGGAAGTGGGG + Intronic
1034280314 7:149849344-149849366 CCCAGCAGTGCTGCGGGGAGTGG - Intronic
1034475233 7:151277764-151277786 CCCCTCTGTGCTGGGCACTGTGG - Intronic
1035737273 8:1898022-1898044 CACATCAGGGATGTGCAGTGGGG - Intronic
1038536711 8:28358878-28358900 CACAGCAGAGCTGAGCAGTGGGG + Intronic
1044404886 8:91816471-91816493 CCCACCAGCCCTGGGCAGTGAGG + Intergenic
1051366659 9:16326063-16326085 CCCAGCAGTCCTGGACAGTGAGG - Intergenic
1053173200 9:35905354-35905376 CTCATCACTGCTGGGCAGGGAGG + Intergenic
1055693118 9:78855632-78855654 CCCTCTAGTGCTGAGCAGTGTGG - Intergenic
1057217222 9:93235790-93235812 CCCCTCAGTGCTGCTCTGCGGGG + Intronic
1061714645 9:132511053-132511075 CCCACCTGTGCTGGGCATTGTGG + Intronic
1203525323 Un_GL000213v1:83239-83261 ACCTCCAGTGCTCCGCAGTGCGG + Intergenic
1190257873 X:48777390-48777412 CCCAAGAGTGCTGCGAAGAGAGG + Intergenic
1197809697 X:130430156-130430178 CCCCTCAGTGCAATGCAGTGGGG - Intergenic
1198149277 X:133892418-133892440 CCCATCATTGCTCAGCAGTCAGG + Intronic