ID: 1066350361

View in Genome Browser
Species Human (GRCh38)
Location 10:34631487-34631509
Sequence CAGGCAGTAGGTAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066350361_1066350369 8 Left 1066350361 10:34631487-34631509 CCCACTTCCTTACCTACTGCCTG 0: 1
1: 0
2: 5
3: 30
4: 325
Right 1066350369 10:34631518-34631540 ACTGATGCCTACAGCATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066350361 Original CRISPR CAGGCAGTAGGTAAGGAAGT GGG (reversed) Intronic
900120705 1:1047544-1047566 CAGGGAGTAGGCAAGGACTTGGG - Intronic
900176206 1:1292518-1292540 CAGGCAGCAGGCAAGAGAGTTGG + Exonic
900942165 1:5806602-5806624 CAGACAGTACGTAAGGAAGTGGG + Intergenic
902322178 1:15675751-15675773 CAGGCAGTAGGTAGGTAGGTAGG - Intergenic
903201454 1:21743163-21743185 CAGGCTGTGGGTAAGGAAGAGGG + Intronic
903474540 1:23610535-23610557 CAGGCTGTATGCAAGGAATTAGG - Intronic
905506866 1:38486654-38486676 CAGGCAGGAGGAAGGGAAGAAGG + Intergenic
905676320 1:39827912-39827934 CAGGCACTAGATAAGGACTTTGG - Intergenic
905900362 1:41577397-41577419 TAGCCAGTAGGTAAGGTAGTGGG + Intronic
905921543 1:41722553-41722575 CAGGCAGAAGGAAGGGAAGGAGG - Intronic
905930569 1:41784023-41784045 CAGGGAGTAGGTAGGGAAGAAGG + Intronic
909425170 1:75516187-75516209 CAGGCTTTAGATAAGGAATTTGG - Intronic
909985892 1:82160161-82160183 CACTCAGAAAGTAAGGAAGTGGG + Intergenic
911675810 1:100656795-100656817 GGGGGAGTAGGTAAGTAAGTGGG + Intergenic
911712296 1:101088082-101088104 CAGGTAGTAGGAAAGGAGGCTGG + Intergenic
911742209 1:101399171-101399193 AAGGCTGCAGGTAAGGATGTGGG + Intergenic
914796937 1:150927793-150927815 CAGGCAGTGGTTGAGGAACTGGG + Exonic
916941675 1:169684384-169684406 CAGGCAGGAGGGAAAGAAGGAGG - Intronic
917713387 1:177710011-177710033 CAGGCAGTGGGACAGGGAGTGGG - Intergenic
920651879 1:207843873-207843895 TAGGCAGTAGGCAAGGCACTAGG - Intergenic
920915949 1:210258116-210258138 CAGACAGCAGTCAAGGAAGTAGG - Intergenic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
921769270 1:219016010-219016032 AAAGCAGTAGCTAATGAAGTAGG + Intergenic
1062877787 10:955995-956017 CAGGCACTGGGGCAGGAAGTGGG - Intergenic
1063335255 10:5206438-5206460 CAGGCAGTAGGACAGGAAGATGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064650355 10:17502813-17502835 CAGGCTGTAGCTCAGGAATTTGG - Intergenic
1065455411 10:25901840-25901862 AAGGGAGTGGGTAAGGAAGGGGG - Intergenic
1066350361 10:34631487-34631509 CAGGCAGTAGGTAAGGAAGTGGG - Intronic
1066432122 10:35362400-35362422 CTGGCAGTAGGGAAGGCAGTAGG + Intronic
1068751268 10:60595344-60595366 CAGGCAGGGGGTTAGGAAATGGG + Intronic
1070823923 10:79380038-79380060 CAGGCAGGAGGAAGGGAGGTGGG - Intergenic
1072155783 10:92722635-92722657 TAGGCAGTAGGTTAGTTAGTTGG - Intergenic
1072653874 10:97317403-97317425 CAGGAAAGAGGTAGGGAAGTTGG - Intergenic
1073394467 10:103206744-103206766 CAGGCGGTAGGGAAAGAAGGAGG - Intergenic
1073506864 10:104002718-104002740 CAGGCAGTTGATAGTGAAGTTGG + Exonic
1073709594 10:106021771-106021793 CAGGCAGGAGGGAAAGAAGGTGG + Intergenic
1073858793 10:107711702-107711724 CTTGCAGAAGGTAATGAAGTTGG - Intergenic
1073891492 10:108107654-108107676 CTTGCACTGGGTAAGGAAGTAGG - Intergenic
1074107664 10:110400460-110400482 CAGGCAGGAGGTAGGGAGGATGG + Intergenic
1075444055 10:122501529-122501551 CTGCCAGCAGGGAAGGAAGTTGG - Intronic
1075700589 10:124467191-124467213 CTGGCAGTAGGGCAGGAGGTGGG + Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1080389854 11:31834806-31834828 AAGGAGGTAGGGAAGGAAGTAGG - Intronic
1081159543 11:39735567-39735589 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1081416729 11:42824241-42824263 CAGGCGATAGGTAAACAAGTGGG + Intergenic
1084235097 11:67782641-67782663 CAGGCAGTAGGAAGGCAAGCTGG + Intergenic
1084630267 11:70343500-70343522 CAGGCAGTATTTAAGAAATTGGG - Intronic
1084947118 11:72644100-72644122 CAGGCAGGAGGGAAGGATCTGGG - Intronic
1085195657 11:74670193-74670215 CAGGCAGGAGGAAAGAGAGTGGG - Intergenic
1085621890 11:78044032-78044054 CAGGAAGTAGGTGAAGAGGTGGG - Intronic
1085774504 11:79353074-79353096 CAGGCAGGGGGAAAGGATGTAGG + Intronic
1086322851 11:85668625-85668647 CAGGAATAAGATAAGGAAGTTGG - Intronic
1086525380 11:87719399-87719421 CAGGGAGGAGGTAAGGGAGGAGG - Intergenic
1087142549 11:94779299-94779321 AAGGCAGGAGGTAAAGTAGTGGG - Intronic
1088113521 11:106290192-106290214 CAGGTAGTAGGTTAGGAAGTTGG - Intergenic
1088257572 11:107915751-107915773 CAGGCATAAGGTAAGGATGTGGG - Intronic
1089661887 11:119991285-119991307 CAGGCAGAGGGAAGGGAAGTTGG + Intergenic
1090236991 11:125156285-125156307 CAGCCAGGAGGAAAGGAACTGGG + Intergenic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1091857636 12:3752487-3752509 AAGGAAGGAGGTCAGGAAGTGGG - Intronic
1092233192 12:6789259-6789281 CAGGCTGTGGGGAAAGAAGTGGG - Intronic
1092489136 12:8929381-8929403 CAGGCTGTGGATAAGGAGGTAGG - Intronic
1093108605 12:15120815-15120837 CAGCCATGAGGAAAGGAAGTGGG - Intronic
1093434304 12:19118182-19118204 CAAGCAGCAGGTAAGGAAGAAGG + Intergenic
1093970081 12:25368584-25368606 AAGCCAGTAGGTATGGCAGTAGG + Intergenic
1099424134 12:82501917-82501939 CAGGAAGAAGGTAAGGAAAAGGG - Intergenic
1101219414 12:102621807-102621829 CAGGGACTAAGTAGGGAAGTGGG + Intergenic
1101549456 12:105748552-105748574 CAGCAAGAAGGCAAGGAAGTTGG - Intergenic
1101597991 12:106184066-106184088 GAGGCCATAGGGAAGGAAGTGGG - Intergenic
1102992117 12:117322746-117322768 AAGGAAGGAGGGAAGGAAGTGGG - Intronic
1104387909 12:128366625-128366647 CAGGCAGCAGGGAAGATAGTGGG + Intronic
1105236588 13:18561596-18561618 CAGGCTATAGGTAAAGAAATTGG - Intergenic
1107310402 13:39071760-39071782 CAAACAGTAGGAAAGAAAGTTGG - Intergenic
1108592654 13:51924644-51924666 CAGGCAGGACGGAAGGAAGCAGG - Intergenic
1110416925 13:75263100-75263122 CAGCTAGTAAGTGAGGAAGTTGG - Intergenic
1111685592 13:91497651-91497673 GAGGCAGAAGGTAATGAATTGGG + Intronic
1113246240 13:108398684-108398706 CAGGAAGTAGGAAAGTAACTTGG - Intergenic
1114781319 14:25541216-25541238 AAGGCAGCAGCAAAGGAAGTTGG + Intergenic
1114791627 14:25666141-25666163 CAAGGAGTGGGTAAGGAGGTCGG - Intergenic
1115814710 14:37151335-37151357 CAGGCAATTGGTCAGGAAGTGGG - Intronic
1115927917 14:38457614-38457636 CAGGCATTAAAGAAGGAAGTAGG + Intergenic
1116548992 14:46210196-46210218 CAGGCAGTAGAAAATGAAGCAGG + Intergenic
1116794766 14:49378171-49378193 CAGGCATCAGGGAAAGAAGTGGG - Intergenic
1116922184 14:50590442-50590464 CAGGCAGAAAGGAAGGAAGTAGG - Intronic
1117848631 14:59941960-59941982 GAGGCTGTAGGCAAGGTAGTGGG - Intronic
1118363512 14:65075404-65075426 AGGACAGTAGGAAAGGAAGTGGG + Intronic
1118966036 14:70586505-70586527 AAGGTAGATGGTAAGGAAGTTGG - Intronic
1120001086 14:79303740-79303762 CAGACAATAAGTAAAGAAGTGGG + Intronic
1120395146 14:83958507-83958529 GATGCAGTTGCTAAGGAAGTAGG + Intergenic
1121539255 14:94712733-94712755 CAGGCAGGAAGGAAGGAAGGAGG + Intergenic
1121791853 14:96704786-96704808 CAGGAAGCAGGTGAGGGAGTTGG - Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1125308039 15:38344603-38344625 CAGCTAGTAAGTAAAGAAGTTGG - Intronic
1125513952 15:40307715-40307737 CAGGCAGAAGGGCAGGAAGGAGG + Exonic
1125968702 15:43894644-43894666 AAGGAAGTAGGGAAGGGAGTTGG + Intronic
1126372742 15:47964488-47964510 CAGGCAGGAGGCAAGCAAGTGGG - Intergenic
1126378294 15:48018898-48018920 CAGGCAGTAAGGAAGGAAGGTGG - Intergenic
1127003561 15:54539326-54539348 TAGGATGTAGGTAGGGAAGTAGG + Intronic
1127107510 15:55632550-55632572 CAGGCAGTAAGAAATGAAGTAGG - Intronic
1127813264 15:62582696-62582718 CAGGCAGGAGGTGAGGAAGTGGG + Intronic
1128771346 15:70284707-70284729 CAGGCCTTAGGTAAGGACCTTGG + Intergenic
1129185485 15:73903524-73903546 CAGGCAGCATGTGAGGGAGTAGG - Intergenic
1129610128 15:77046669-77046691 CAGGTAGTAGGTAAGTAGGTGGG + Exonic
1130033930 15:80341104-80341126 ACAGCAGTAGGTATGGAAGTGGG - Intergenic
1131072512 15:89475046-89475068 CAGGCAGGAAGGAAGGAAGGCGG - Intronic
1132196804 15:99919649-99919671 CAGGCAGAAGTCAAGGATGTGGG - Intergenic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1134196999 16:12166974-12166996 CAGCCAGTGGTTAAGGAAGGTGG + Intronic
1134310495 16:13071627-13071649 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1134386734 16:13780546-13780568 CAGGCAGTATGTAAATGAGTGGG - Intergenic
1135645344 16:24156802-24156824 AAGGGAGAAGGTAAGGGAGTAGG - Intronic
1136521941 16:30802461-30802483 CAGCCAGCAGGTAAGGAATCTGG + Intergenic
1136677415 16:31923929-31923951 CAGCCAGAAGATAAGGAAGGGGG + Intergenic
1138209156 16:55148500-55148522 CAGCAAGAAGATAAGGAAGTAGG + Intergenic
1138386813 16:56641091-56641113 CAGCCAGTAGGTGGTGAAGTGGG - Intronic
1140464639 16:75170872-75170894 CAAGCAGTAGGGAAAGACGTAGG - Exonic
1141700945 16:85641801-85641823 CAGCCAGTGAGTAGGGAAGTGGG - Intronic
1143518292 17:7430853-7430875 CCGGGAGTAGGCAAGGAATTTGG - Intergenic
1144163085 17:12581000-12581022 CAGATACTAGGTAAGAAAGTGGG - Intergenic
1146634047 17:34491081-34491103 GAGGAAGGAGGGAAGGAAGTAGG + Intergenic
1147418663 17:40311216-40311238 CAGGCAGGAGGGAAGCCAGTGGG + Intronic
1149387033 17:56152700-56152722 CAGGCACTAGGTGAGGAATCAGG + Intronic
1150212675 17:63450013-63450035 CAGGCACTAGGTGAGGTATTGGG + Intergenic
1150657087 17:67046427-67046449 CAAGCAGGAGGGAAGGAAGAGGG - Intronic
1151484504 17:74389915-74389937 AAGGAAGGAGGTAAGGAAGGGGG - Intergenic
1151484543 17:74390189-74390211 AAGGAAGGAGGTAAGGAAGGGGG - Intergenic
1152241521 17:79163701-79163723 CAGCCAGGAGGGAAGCAAGTGGG - Intronic
1155492764 18:26416404-26416426 CAGCCAGTAAGTAGTGAAGTTGG - Intergenic
1155628123 18:27860185-27860207 CAGGCAGAGGCTGAGGAAGTCGG - Intergenic
1156530469 18:37810181-37810203 CAGGGAGTGGGTAAGGAATGAGG - Intergenic
1156565338 18:38182623-38182645 AAGGCAATAGGTAAAGAAGGGGG + Intergenic
1157427808 18:47599147-47599169 GTGGCAGTAGGTAAAGAAATAGG - Intergenic
1157486776 18:48093261-48093283 GAGGCAGGAGGTCAGGAAGAAGG - Intronic
1157805202 18:50652648-50652670 GATGCAGTAGGTTAGGAATTAGG + Intronic
1157946003 18:51981553-51981575 CAGGCACCAGGAAGGGAAGTTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158810955 18:61033735-61033757 TAGGTAGTAGGTAGGGTAGTAGG - Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159254784 18:65931619-65931641 CAGTCAGGAGGCAGGGAAGTAGG - Intergenic
1159310094 18:66696904-66696926 CAGGCATTAGGTAGGTAGGTAGG + Intergenic
1161015633 19:1981472-1981494 GAGGCGGAAGGTAAGGAAGATGG + Intergenic
1162461885 19:10818305-10818327 CAGGCTCTAGGCAAAGAAGTAGG - Intronic
1163402477 19:17102463-17102485 GAGGCAGTGGATGAGGAAGTTGG - Exonic
1165768707 19:38366257-38366279 CAGGGAGTGGGTAGGGAAATGGG - Intronic
1166072660 19:40395959-40395981 CAGGCAGAAGGGATGGAATTTGG - Exonic
1166076800 19:40418355-40418377 AAGGCAGGAGGGAAGGAAGGAGG - Intergenic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166887540 19:45971399-45971421 CAGGAAGGAGGGAAGGAAGTCGG + Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1168050878 19:53828905-53828927 AAGGCAGAAGGAAAGGAAATAGG + Intergenic
1168248020 19:55124079-55124101 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
925693870 2:6553434-6553456 CAGGCAGAAGTTAATGATGTAGG - Intergenic
926630733 2:15133981-15134003 CAGGCAGTGGGCATGGAAGTGGG - Intergenic
926745689 2:16155361-16155383 CAGTTTCTAGGTAAGGAAGTTGG + Intergenic
926991140 2:18681657-18681679 AAGGAGGTAGGTGAGGAAGTTGG + Intergenic
927840912 2:26443031-26443053 AAGGCTGTAGTTAAGGAAATGGG + Intronic
928033118 2:27798170-27798192 CATGGAGCAGGAAAGGAAGTTGG + Intronic
930506042 2:52283901-52283923 CAAGCAGAAGGGAAGGAAGGGGG + Intergenic
931335193 2:61334484-61334506 CTGGAAGTAGGAAAGGAGGTTGG + Intronic
931569459 2:63653076-63653098 CTGGCAGTAGCTCAGGAAGAGGG + Intronic
934649694 2:96083812-96083834 CAGGCACTAAGGAAGGAAGAGGG - Intergenic
937639631 2:124196881-124196903 CAGGCAGAAGACAAGGAAATGGG - Intronic
939460846 2:142494009-142494031 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
940886670 2:158995792-158995814 AAGGCAGTAGGTAAGGCAGTGGG - Intronic
941438680 2:165506317-165506339 AAGGGAGTAGGCATGGAAGTTGG - Intronic
942296640 2:174523901-174523923 CTGGCAGTAGGAGAGGAAGGAGG - Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
943883366 2:193178156-193178178 CAGTCAGTAGAAAAGGAAATAGG - Intergenic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
946336905 2:219043723-219043745 CAGGCAGTTGGTAATAGAGTTGG - Intergenic
946766204 2:223043384-223043406 CAGGAAGTGGGGCAGGAAGTGGG - Intergenic
1169544638 20:6637999-6638021 CAGGCAATAGGTAAGGAAGGTGG - Intergenic
1170394594 20:15912289-15912311 TGGGCAGTAGATAAGGAAATTGG - Intronic
1170881022 20:20296434-20296456 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1171862464 20:30413165-30413187 CAGGAAGGAGGGAAGGAAGAAGG + Intergenic
1172080987 20:32340500-32340522 TGGGCAGTAGGTTAGGAAGGTGG + Intergenic
1173594994 20:44253182-44253204 CAGGCAGATGGTAAGCAATTTGG - Intronic
1173618963 20:44422158-44422180 CAGGTGGTAGGTAAGAATGTGGG - Intronic
1174435363 20:50502766-50502788 CAGCCAGTAGGTAGTCAAGTGGG - Intergenic
1174803966 20:53591034-53591056 CAGGTAGTAGGGGAGGAAGGAGG - Intronic
1175031816 20:55962324-55962346 CAGGCACCAGCAAAGGAAGTAGG + Intergenic
1175291073 20:57875751-57875773 CAGGCAAGAGGAAAGGAATTAGG - Intergenic
1176780576 21:13189882-13189904 CAGGCTATAGGTAAAGAAATTGG - Intergenic
1177978256 21:27878993-27879015 CAGGCTATAGGTAAAGAAATTGG - Intergenic
1178799448 21:35778926-35778948 CAGACAGAAGGAAAGGAAGAGGG + Intronic
1179961941 21:44772547-44772569 GAGGCAGTAGGTGATGGAGTAGG - Intronic
1181438385 22:22923266-22923288 CAGGCAGGAGGCAGGGAGGTGGG - Intergenic
1181485320 22:23227224-23227246 CACACAGTAGGTACGGAAGGTGG - Intronic
1183055081 22:35300194-35300216 CAGCCAGTAGGTAAGGAGAGAGG + Intronic
1183629218 22:39023005-39023027 CAGGCAGGAGGTAAGCAGCTGGG + Exonic
1184484103 22:44765786-44765808 CAGGCAGCTGGTCAGGAAGAAGG - Intronic
1184889770 22:47372502-47372524 CTGGCAGCAGGTGAGGAACTGGG - Intergenic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1185027929 22:48426158-48426180 CAGGAAGTGTGTAAGGAAGGTGG - Intergenic
1203294056 22_KI270736v1_random:23436-23458 CAGGCAGTAGGCTAGGCACTAGG - Intergenic
950865090 3:16182494-16182516 CAGGAAGTAAGTAAGGAACAGGG + Intronic
951762911 3:26164536-26164558 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
952296708 3:32068778-32068800 CAGGCAGGAGGGAAAGAAGGAGG - Intronic
953043105 3:39272409-39272431 CAGGCATGAGAAAAGGAAGTAGG - Intronic
953543232 3:43841072-43841094 CAGGAAGTGAGTAAAGAAGTGGG - Intergenic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
955123327 3:56083828-56083850 CAGGAAGTAGAGAAGCAAGTAGG + Intronic
955274844 3:57537350-57537372 GAGGTAGTAGCTAAGGAAGAAGG + Intronic
955795390 3:62631196-62631218 TAGGTGGTAGGTAATGAAGTTGG + Intronic
956203920 3:66736664-66736686 GAGGCAGTAGGGAGGGAAGAGGG - Intergenic
956789041 3:72666555-72666577 CAGCTAGTAAGTAAGGAAATTGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
958252859 3:91290978-91291000 CATGTAGTGGGTAAGGAAATGGG + Intergenic
960275837 3:115728261-115728283 GAGGCAGGAGGTCAGAAAGTAGG - Intergenic
961381785 3:126500244-126500266 CAGGCAGTGGGGCTGGAAGTTGG - Intronic
962248722 3:133821383-133821405 CAAGCAGTAACTTAGGAAGTAGG + Exonic
964036515 3:152205793-152205815 CAGGTAATAGATAAGGAAATGGG - Intergenic
964125569 3:153230865-153230887 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
965781020 3:172286059-172286081 CACACAGTAGGTAAGGAAAAGGG + Intronic
965796302 3:172442987-172443009 CAGGGAGTAGTTAATGTAGTAGG - Intergenic
966431155 3:179832627-179832649 GAGGGGGTAGGTAAGTAAGTAGG - Intronic
968449852 4:669974-669996 CAGGCAGGAGGGAAGGAATAGGG + Intronic
969820045 4:9713118-9713140 CAGGCAGTAGGAAGGCAAGCTGG - Intergenic
971230461 4:24796976-24796998 CAGGGAGTAGGCAGGAAAGTGGG - Intronic
971677064 4:29645604-29645626 GAGGCGGGAGGTGAGGAAGTAGG + Intergenic
972234041 4:37109288-37109310 CAGGCAGCAGGTCAGCAGGTGGG - Intergenic
974059112 4:57014120-57014142 CAGGCAGTAGACTAGGAACTTGG + Intronic
976775176 4:88698939-88698961 AAGGCAGTGGGTGAGGAAGAAGG - Intronic
976834443 4:89355152-89355174 CAGGGAGCGGGTAAGGCAGTAGG - Intergenic
977000107 4:91487502-91487524 CAGGTAGTAAGTCAGGAAATGGG + Intronic
977041911 4:92027411-92027433 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
977679913 4:99786993-99787015 CAGGCAGTGGGGTAGGAAATGGG - Intergenic
977734572 4:100398290-100398312 CCAGCAGCAGGTATGGAAGTCGG + Exonic
978228507 4:106367918-106367940 CAGGCAGTGGGTCGGGAAGTGGG - Intergenic
980264624 4:130499362-130499384 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
982321069 4:154078022-154078044 CTGACAGGAGGAAAGGAAGTGGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
987166444 5:15203160-15203182 AAGGCAGCATGTAAGAAAGTGGG + Intergenic
989107328 5:37876061-37876083 GAGGAAGTAGGGAAGGAAGGAGG - Intergenic
990851039 5:60205179-60205201 CAGGCAGTGGGTCATGAAGCTGG - Intronic
991135813 5:63180551-63180573 GAGGCAGTAGGTAAGAATATAGG + Intergenic
991661012 5:68950696-68950718 CAGGCAGTAAGGAAGGAAAATGG + Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992496893 5:77302544-77302566 GAGGAAGCAGGTAGGGAAGTCGG - Intronic
992886576 5:81165929-81165951 CAGACAGTAGGAAAGGATGATGG - Intronic
995603569 5:113825866-113825888 CAGGAAGTAGGATAGGAAGGTGG + Intergenic
996523083 5:124448811-124448833 TAGGCAGGAGGTTAGGAACTTGG + Intergenic
997096587 5:130920024-130920046 CAGGCAATGGGTAAGGAATTGGG + Intergenic
998484620 5:142490849-142490871 CAGGAATGAGGTAAGCAAGTTGG + Intergenic
998684373 5:144506953-144506975 TAGGCAGGAGGTTAGGGAGTGGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
998910918 5:146959481-146959503 CAGGCAATAGGTGAGGTACTGGG - Intronic
998920053 5:147058105-147058127 CAGGCACTAGGTGAGGCAGTAGG - Intronic
999357054 5:150945604-150945626 TAGGGAGTGGTTAAGGAAGTGGG - Intergenic
999538100 5:152540927-152540949 AAGGCAGTAGCTAGGGAGGTAGG - Intergenic
1000530723 5:162416537-162416559 CAGACAGGAGGTAAGTAATTTGG - Intergenic
1001919435 5:175588733-175588755 GAGGGAGGAGGGAAGGAAGTAGG + Intergenic
1002043477 5:176530081-176530103 CAGGAAGTAGGGCAGGAAGCTGG + Exonic
1002082845 5:176747822-176747844 CAGGCAGCTGGTGAGGCAGTGGG + Intergenic
1002795581 6:468542-468564 CAGGTAGGAGGCAAGGAAATTGG + Intergenic
1004247667 6:13995775-13995797 CAGGCAGAAAGAAAGGGAGTGGG + Intergenic
1005004396 6:21273394-21273416 TATACAGTAGGTAAGGAAGAAGG - Intergenic
1006145974 6:31959967-31959989 GAGGCATTAGGTAAGGAAAGAGG - Intronic
1006397895 6:33798886-33798908 CAGGCACCAGATAAGGAAGTAGG - Intronic
1007547987 6:42708646-42708668 CAGCCTGTAGGTCAGGAGGTGGG - Intronic
1008344061 6:50404640-50404662 CAGGCAGTAGGTCAGACATTGGG - Intergenic
1008931662 6:56946751-56946773 CTGGCTGAAGGTAAGGGAGTAGG + Intronic
1012413923 6:98991935-98991957 CAGTCAGTAGGTCAGGTATTAGG + Intergenic
1013279354 6:108621318-108621340 CAGGCAGTTGGCAAGGCAGCGGG - Intronic
1013753364 6:113433024-113433046 CTCCCAGTAGGTAAGCAAGTTGG - Intergenic
1013773651 6:113654472-113654494 AAGGGAGGAGGTAAGGAAGTTGG - Intergenic
1014610724 6:123541495-123541517 TAGACAGTAGGTATGGAGGTTGG - Intronic
1015657663 6:135537989-135538011 CAGGCACAAGGTAAGTATGTGGG - Intergenic
1016448478 6:144156775-144156797 CATGCAGTAGTCAAGGAAGAGGG - Intronic
1016709847 6:147156969-147156991 CAGAGAGTAGGTCAGGAAGAGGG + Intergenic
1017856622 6:158355447-158355469 CAGGTAGTAGACAAGGAAGCTGG + Intronic
1018231907 6:161683165-161683187 GAGGCAGAAGGGAAGGAAGAAGG + Intronic
1018562709 6:165118795-165118817 CAGGCAGCGGGCTAGGAAGTGGG + Intergenic
1020318121 7:6921179-6921201 CAGGCAGTAGGAAGGCAAGCTGG + Intergenic
1021055600 7:16042741-16042763 CAGGAAGTAGGTGAAGAACTGGG + Intergenic
1021172553 7:17415334-17415356 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1021198460 7:17698663-17698685 CAGACAGTAGCTATGAAAGTTGG - Intergenic
1021412132 7:20340744-20340766 CAGGTACTAGGTAGGGAAGGGGG + Intronic
1021812751 7:24419185-24419207 CAGGAATTAGGAAAGGAAATGGG + Intergenic
1024644999 7:51363487-51363509 CAGACAGAAGGTAAGGAAAGAGG - Intergenic
1026879095 7:73897364-73897386 GTGGCAGTAGGTAAAGAAGAGGG - Intergenic
1027340976 7:77208671-77208693 GTGGCAGTAGTTAGGGAAGTAGG - Intronic
1028610886 7:92710328-92710350 TAAGCAGTAGGTGAGGAAGCAGG - Intronic
1029374125 7:100167744-100167766 CAGGCAGGAGGAAGGGAGGTTGG + Intronic
1029500101 7:100923703-100923725 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1030940160 7:115636872-115636894 CAGTCAGTAAGTACTGAAGTGGG + Intergenic
1032908114 7:136396117-136396139 CAGGCAGGAAGGAAGGAAGAAGG + Intergenic
1033378742 7:140791224-140791246 AAGGCAGCAGGTGAGGAAGTAGG - Intronic
1034551631 7:151824304-151824326 CAGGCAGGATGACAGGAAGTGGG - Intronic
1035874030 8:3167492-3167514 CAGGCATTGGGAAAGGAGGTGGG + Intronic
1036564072 8:9923293-9923315 CAGGCAGAAGGTAAGGAGAAGGG - Intergenic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1036978991 8:13447483-13447505 CAGCTAGTAAGTAAGGAAGATGG + Intronic
1037053797 8:14410218-14410240 CAGGCAGAAGGAAAGGGAGGAGG - Intronic
1037998208 8:23368598-23368620 AAGGCAGTAGGTAAAGGAGGTGG - Intronic
1038182804 8:25244706-25244728 AAGGCAGGAGGAAAGGAAGCAGG + Intronic
1038239824 8:25798216-25798238 CAGCCTGTAGGCAAGGAAGATGG + Intergenic
1038446478 8:27607881-27607903 GAGCCAGAAGGCAAGGAAGTAGG - Intronic
1040441543 8:47448607-47448629 CAGCCAGTAGGTAGGTCAGTAGG + Intronic
1042418788 8:68560245-68560267 CATGCAGTAGGGAAAGAAGGAGG + Intronic
1043161458 8:76852702-76852724 CAGGCAGAAGGTACAGAAGAAGG + Exonic
1043485181 8:80692162-80692184 CAGGCAGTAGGAGGTGAAGTTGG - Intronic
1043598730 8:81914964-81914986 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1043880070 8:85532045-85532067 GAGTCAGTAGGGAAGGATGTGGG - Intergenic
1044955073 8:97471613-97471635 TGGGCTGTAGGGAAGGAAGTTGG - Intergenic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046670290 8:117049607-117049629 CAGGCAGTAGATAAAGAGGATGG - Intronic
1046805252 8:118473063-118473085 CTGGCAGGAGGTGAGGCAGTGGG + Intronic
1047054711 8:121151276-121151298 CAGTCAGTATGTAAGGAACCAGG - Intergenic
1049035328 8:140071205-140071227 CAAGCTGTAGGTAAGGCAGTGGG - Intronic
1049314540 8:141956124-141956146 CAGGCAGAAGGTAAAGAAACAGG + Intergenic
1049700673 8:144010311-144010333 CAGGCATTATGTTAGGAATTGGG - Intronic
1049742247 8:144246785-144246807 CAGGGAGGAGGTGTGGAAGTAGG + Intronic
1051105744 9:13577950-13577972 CAGGCAATGGGTGAGGAAGTGGG + Intergenic
1051265982 9:15308523-15308545 CAGACAGCAGTTAAGTAAGTAGG + Intergenic
1051465195 9:17368746-17368768 CAGGCAGTAGTTCTAGAAGTCGG + Intronic
1053139400 9:35673491-35673513 CAGGAAGCAGGTAAAGAGGTAGG - Intronic
1053461101 9:38272176-38272198 CAGCCAGTCAGTGAGGAAGTGGG - Intergenic
1054822612 9:69538542-69538564 TAGGCTATAGGAAAGGAAGTTGG - Intronic
1055627377 9:78188000-78188022 AAGGCAGAAGGGAGGGAAGTTGG - Intergenic
1056737093 9:89219326-89219348 AAGGCAGCAGGGAAGGAGGTGGG - Intergenic
1058171277 9:101684068-101684090 CAGGAAGAAGGAAAGGAAGGGGG - Intronic
1059093540 9:111387953-111387975 CAGGCACTGGGTAAGGTACTGGG - Intronic
1059130908 9:111748681-111748703 CAGGCAGCTGGAAAGGAAGGAGG - Intronic
1059136401 9:111810766-111810788 CAGGTAGTGGCTCAGGAAGTGGG - Intergenic
1061792317 9:133065109-133065131 CAGGTAGTTGTTGAGGAAGTTGG - Exonic
1062276226 9:135732816-135732838 CAGGAAGGAGGGAAGGAAGAAGG - Intronic
1186207223 X:7213468-7213490 CAGGCAGGAGGGCAGGAAGGTGG + Intergenic
1186484474 X:9923432-9923454 AAGGAAGTGGGTAAGAAAGTGGG + Intronic
1187203526 X:17159304-17159326 GAGGTAGAAAGTAAGGAAGTTGG - Intergenic
1187650648 X:21401197-21401219 CAGGAAGAAAGTAAGGAGGTTGG + Intronic
1187956548 X:24524308-24524330 CATGCAGTAGGTATGGAAGCTGG + Intronic
1187956551 X:24524327-24524349 CTGGAAGTAGGTATGGAAGCTGG + Intronic
1188536644 X:31203839-31203861 TAGGCAGTAGGTATGGGATTTGG - Intronic
1189683411 X:43539659-43539681 AAGGCACTAGGTAATGAGGTGGG - Intergenic
1189914697 X:45845296-45845318 TTGCCAGTAGCTAAGGAAGTGGG + Intergenic
1190522485 X:51294456-51294478 CAGGCAGTGAGCAAAGAAGTGGG + Intergenic
1192216517 X:69163155-69163177 CAGGTAGGAGGTATGGAAGAAGG - Exonic
1193867385 X:86751706-86751728 CAGGCAGGAAGGAAGGAAATAGG + Intronic
1195996990 X:110741506-110741528 CAGGCCCTAAGTAAGGAAGTAGG + Intronic
1196179189 X:112671601-112671623 CAGGCAGAAGGAAGGGAAGGTGG - Intronic
1196221089 X:113112854-113112876 CAGGCAGGAGGGAAAGAAGGAGG + Intergenic
1196396203 X:115264130-115264152 CAGGCACTAGATAAGCAGGTAGG - Intergenic
1197499608 X:127228125-127228147 CAGGCAGGAGGGAAAGAAGGAGG - Intergenic
1197641627 X:128974511-128974533 GAGGCAGAAGGGAAGGAAGGAGG + Intergenic
1197862198 X:130982891-130982913 AAGGCAGTAGGGATGGGAGTGGG - Intergenic
1198098514 X:133403633-133403655 CATGCAGTATGTTAGGAACTGGG + Intronic
1198129006 X:133675511-133675533 CAGGTACTGGGTAAGGGAGTGGG - Intronic
1198417598 X:136436158-136436180 GAGTCAGTAGGTTTGGAAGTGGG + Intergenic
1198466771 X:136910365-136910387 CAGCCAATAGGGAGGGAAGTGGG - Intergenic
1199267334 X:145843823-145843845 CAGGCAGAAGGTAAGCAGGCAGG + Intergenic
1199708872 X:150453804-150453826 CAGGCAGGAGGGCAGCAAGTGGG - Intronic
1200887521 Y:8284154-8284176 CATGCATTAGTTCAGGAAGTAGG + Intergenic
1200950950 Y:8899798-8899820 CATGCATTAGTTCAGGAAGTAGG - Intergenic
1201640298 Y:16170599-16170621 CAAGCAGTAGGAGAGGAATTTGG - Intergenic
1201662516 Y:16414726-16414748 CAAGCAGTAGGAGAGGAATTTGG + Intergenic
1201784555 Y:17759817-17759839 CAGGCAGAGGGTAAAAAAGTTGG - Intergenic
1201816998 Y:18146170-18146192 CAGGCAGAGGGTAAAAAAGTTGG + Intergenic
1202047164 Y:20746830-20746852 CAGGCAGTACATAAAGAAATGGG + Intergenic