ID: 1066367792

View in Genome Browser
Species Human (GRCh38)
Location 10:34793478-34793500
Sequence CAGAGTAAACTTTCTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066367792_1066367799 -7 Left 1066367792 10:34793478-34793500 CCATCCTTAGAAAGTTTACTCTG 0: 1
1: 0
2: 1
3: 7
4: 185
Right 1066367799 10:34793494-34793516 TACTCTGGGAAGGCTGGGCACGG No data
1066367792_1066367805 27 Left 1066367792 10:34793478-34793500 CCATCCTTAGAAAGTTTACTCTG 0: 1
1: 0
2: 1
3: 7
4: 185
Right 1066367805 10:34793528-34793550 TGTAATCCCGGCACTTTGGGAGG 0: 2670
1: 294815
2: 268411
3: 154339
4: 131866
1066367792_1066367802 23 Left 1066367792 10:34793478-34793500 CCATCCTTAGAAAGTTTACTCTG 0: 1
1: 0
2: 1
3: 7
4: 185
Right 1066367802 10:34793524-34793546 CACCTGTAATCCCGGCACTTTGG 0: 704
1: 71864
2: 207284
3: 251311
4: 205256
1066367792_1066367800 15 Left 1066367792 10:34793478-34793500 CCATCCTTAGAAAGTTTACTCTG 0: 1
1: 0
2: 1
3: 7
4: 185
Right 1066367800 10:34793516-34793538 GTGCCTCACACCTGTAATCCCGG 0: 15
1: 1234
2: 3069
3: 4302
4: 4530
1066367792_1066367803 24 Left 1066367792 10:34793478-34793500 CCATCCTTAGAAAGTTTACTCTG 0: 1
1: 0
2: 1
3: 7
4: 185
Right 1066367803 10:34793525-34793547 ACCTGTAATCCCGGCACTTTGGG 0: 730
1: 75818
2: 305576
3: 246162
4: 150288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066367792 Original CRISPR CAGAGTAAACTTTCTAAGGA TGG (reversed) Intronic
904827173 1:33281160-33281182 CTGAGTTAATTTTCTGAGGATGG + Intronic
907767578 1:57425250-57425272 AACGGTAAACTTTTTAAGGAAGG - Intronic
908234366 1:62135728-62135750 CAGAGCAACCTTTTTAAGAAAGG - Intronic
909756583 1:79232978-79233000 CAGAGTAATGTTTCTAGGAAAGG + Intergenic
910236506 1:85042071-85042093 CAGAGTATATTTTATATGGAAGG + Intronic
910937843 1:92500542-92500564 CATAATAACCATTCTAAGGATGG + Intergenic
911119767 1:94284151-94284173 CAGAGAAAAAATTCAAAGGAAGG + Intergenic
917578381 1:176348471-176348493 CAAAGGTAACATTCTAAGGATGG + Intergenic
918186215 1:182129822-182129844 CAGAGTGAACTTCCTAACAATGG - Intergenic
919324671 1:196091474-196091496 CAGATTATACTTTCCAAAGATGG - Intergenic
920637484 1:207718287-207718309 CAGAGTAATATATCAAAGGAAGG - Intronic
921380156 1:214516365-214516387 CAGAGTATCCTTTGCAAGGATGG + Intronic
923168352 1:231389302-231389324 CAGAGTAAACTATAAAATGAGGG + Intronic
923894839 1:238258707-238258729 CAGATTATACTGTCTAAGGTGGG - Intergenic
1063241450 10:4174172-4174194 CAGAGGAAAGTGTCTCAGGAAGG - Intergenic
1063552701 10:7048103-7048125 CAGATTAATCCTTCTCAGGATGG - Intergenic
1063574796 10:7252048-7252070 TAGAGTCAGCTTTCTAAGCAGGG + Intronic
1066367792 10:34793478-34793500 CAGAGTAAACTTTCTAAGGATGG - Intronic
1071120533 10:82271780-82271802 GAGAGTAAACTTCCTTAGAAAGG - Intronic
1074064058 10:109996686-109996708 CAGACTAAACTTTCAGAGCAAGG - Intronic
1074374414 10:112927468-112927490 CAGAGTGCATTTTCTAAAGATGG - Intergenic
1078700880 11:13681360-13681382 CAGACTGTATTTTCTAAGGATGG + Intronic
1080837242 11:35950696-35950718 CAGAGTAAACCTTCAATGAATGG - Intronic
1082817266 11:57517352-57517374 TAGAGTCAACTTTCTAAGCTAGG + Intergenic
1085375468 11:76056842-76056864 CTCAGTAATCTTTCTGAGGAAGG + Intronic
1086421058 11:86637698-86637720 CACAGGAAACTTTTTAAGAAGGG + Intronic
1086610547 11:88749836-88749858 CAAACTAAACTTTATAAGTAAGG + Intronic
1088785533 11:113178280-113178302 AAGAGTAAAATAACTAAGGATGG + Intronic
1091109122 11:132949026-132949048 CAGAGGGAACTTTCTCAGGTAGG + Intronic
1093271724 12:17070796-17070818 CAAAGTAAATGCTCTAAGGAAGG + Intergenic
1094310221 12:29072582-29072604 CAGAGTATACTCCCTAATGAGGG + Intergenic
1096575055 12:52547630-52547652 CCGAGGAGGCTTTCTAAGGAGGG + Intronic
1098554532 12:71803808-71803830 CAGTGTGAACTTTCATAGGAAGG - Intergenic
1101405365 12:104423906-104423928 CAGAGTAAATTTTCAAAAAAAGG - Intergenic
1102590009 12:113949870-113949892 GAGAGTAAACTGACTTAGGAGGG - Intronic
1103043998 12:117720128-117720150 CAGAGTCAAATTTCTATAGATGG + Intronic
1104686430 12:130787946-130787968 CACAGTGAACTTGCGAAGGATGG + Intergenic
1105936679 13:25106944-25106966 CACAGGAAACTTTCTTAGTAAGG + Intergenic
1106124056 13:26885658-26885680 CATGATAAGCTTTCTAAGGAGGG - Intergenic
1106425025 13:29619801-29619823 CAGAAAAAACTTTCTAAGGATGG - Intergenic
1107022221 13:35764027-35764049 CAAAGTGAACTTTCGCAGGAGGG - Intergenic
1109131178 13:58587860-58587882 CAGAGTAAAATTTATAAGAATGG - Intergenic
1110094628 13:71501424-71501446 CAGTGTATATTTTCTAAAGATGG - Intronic
1110584970 13:77178897-77178919 CAGAGTATACTATCAAAGGAAGG + Intronic
1111240730 13:85471083-85471105 CAGAGTCATCTTATTAAGGAAGG + Intergenic
1111510292 13:89252752-89252774 CAGAATAAACTTTCTGAAAATGG - Intergenic
1112377699 13:98859136-98859158 CAGACAAAACCCTCTAAGGAAGG + Intronic
1112484846 13:99810933-99810955 CTTTGTAAACTTTCTTAGGAAGG - Intronic
1112588477 13:100741335-100741357 CACAGCAAAATTTCTAAGAAAGG - Intergenic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1114146806 14:19986552-19986574 CAGATTAAAAATTCTAAGTATGG + Intergenic
1117544214 14:56778804-56778826 CAAAGTAATCTTCATAAGGAAGG + Intergenic
1117974600 14:61284603-61284625 CAGAGTTCACTATGTAAGGAAGG + Intronic
1118625305 14:67653525-67653547 CAGAGTATACTTTTTAAAGAGGG - Intronic
1118676545 14:68191565-68191587 CAGTGCATACTTTCTAGGGAAGG + Intronic
1119143751 14:72291669-72291691 CAGAGTAGCATTTCTAAAGATGG + Intronic
1125817172 15:42595932-42595954 CACAGTCAAGTTTCTAAAGACGG - Intronic
1126332088 15:47543871-47543893 AAGAGTAAAGTTTATAAAGATGG + Intronic
1127045865 15:55025105-55025127 CAGAGTAAAATTTAAAAGGTAGG + Intergenic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1128927887 15:71675429-71675451 CAGAGAAGACTGTCTAAGGCTGG - Intronic
1130111777 15:80971360-80971382 CCAACTAAAGTTTCTAAGGAGGG - Intronic
1130958826 15:88646343-88646365 CTGAGTAAGCTGTCCAAGGAAGG + Intronic
1131106299 15:89737090-89737112 CAAAGGGGACTTTCTAAGGATGG + Intronic
1131654857 15:94445255-94445277 AAGAATAAACTTTCTCTGGAGGG - Intronic
1132285969 15:100662737-100662759 CAGAATAAAACTTCTAAGTAAGG - Intergenic
1137701332 16:50500151-50500173 CACAGTAAACATTCAATGGACGG - Intergenic
1137987195 16:53119092-53119114 TAAGGTAAACTTTCTAAAGAAGG + Intronic
1138202776 16:55102322-55102344 CAAAGTCAACGTGCTAAGGATGG + Intergenic
1139371333 16:66471208-66471230 CAGAGTTAACTGGTTAAGGAGGG + Intronic
1141038816 16:80654268-80654290 CACAGTAATCTTCCTTAGGAGGG - Intronic
1141052817 16:80787411-80787433 CCTAGGAAACTTCCTAAGGAAGG - Intronic
1143117271 17:4588164-4588186 CAGTGTGAACTGTCTTAGGATGG + Intronic
1145426978 17:22912317-22912339 CAGCCTGAACTTTCAAAGGAAGG - Intergenic
1145433805 17:23006299-23006321 CAAACTGAACTTTCAAAGGAAGG - Intergenic
1145434852 17:23020576-23020598 CAGCCTGAACTTTCAAAGGAAGG - Intergenic
1145438277 17:23068162-23068184 CAAACTGAACTTTCAAAGGAAGG - Intergenic
1148958741 17:51375295-51375317 AAAAGTAAACTTTCGGAGGAGGG + Intergenic
1150531812 17:65991614-65991636 CAGAATAAAATTTCTTATGAAGG + Intronic
1153276723 18:3374823-3374845 GAGAGAAACCTTTCAAAGGAAGG - Intergenic
1156989118 18:43385039-43385061 CAGATTATACTTTCTAAAAATGG + Intergenic
1158134906 18:54197434-54197456 CAGTGTAAATTCCCTAAGGAAGG - Intronic
1158325262 18:56307011-56307033 CAGAGGGAACCTTCTAATGAAGG + Intergenic
1160081620 18:75732910-75732932 CAAAGTAAACTTTGAAAGAAGGG + Intergenic
1162932664 19:13965103-13965125 CAGATAAAACTTTTTAAGAAAGG - Intronic
1164578830 19:29421885-29421907 CAGAGGAAACTGTCTAACGCTGG + Intergenic
926600529 2:14839483-14839505 CAGGGTAAAGTTTCCAAGGCTGG - Intergenic
929311924 2:40435463-40435485 GAGAGGAAACTTTCTTTGGAAGG - Intronic
929335406 2:40737916-40737938 CATAGAAAACGTCCTAAGGAAGG - Intergenic
932895134 2:75632000-75632022 CTGAGTAGAATTTCTTAGGAAGG - Intergenic
933441041 2:82314873-82314895 CAGAATATACTTTGTAATGATGG + Intergenic
936344351 2:111663825-111663847 GAGACTAAACTTTGGAAGGATGG - Intergenic
937710231 2:124972357-124972379 GAGAGTAAAGTTGCTATGGAGGG + Intergenic
938690890 2:133788062-133788084 CAGAGTGAACTATTTAAGAAGGG + Intergenic
939000242 2:136726503-136726525 CAAACTAAACTTTATAAGTAGGG - Intergenic
939322188 2:140638489-140638511 AAGATTAAACTCTCTGAGGATGG + Intronic
939711375 2:145524467-145524489 CAGAAAACACTTTCGAAGGAGGG - Intergenic
940396760 2:153198788-153198810 CATACCAAACTTTCTGAGGAAGG - Intergenic
940638214 2:156322642-156322664 GAGATTAAACTTTGTAATGAGGG - Intergenic
942395265 2:175540461-175540483 CAGAATTAAGTTTGTAAGGAGGG + Intergenic
943361837 2:186928899-186928921 CAGAGTAGTCTTTCTGATGAGGG - Intergenic
945658713 2:212658170-212658192 CAGAGTAAGTTTTATAAGCAAGG - Intergenic
945960914 2:216134219-216134241 CAGAGAAAACTTTTTAAAGAGGG - Intronic
946571607 2:221029887-221029909 GAGGGTAAAGTTTCTTAGGAGGG - Intergenic
946634525 2:221709810-221709832 CATAGTAAGCCTTCTAAGGGTGG - Intergenic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1173987993 20:47277591-47277613 GAGAATAAGCTTTCCAAGGAAGG + Intronic
1178832169 21:36065076-36065098 CAGCTTAAACATTCTCAGGAAGG - Intronic
1178914852 21:36700453-36700475 CAGAGTGAACTTCCAAAGAAAGG - Intronic
1184218340 22:43082292-43082314 CAGAGCCAATTTTCTGAGGATGG - Intronic
949324845 3:2851888-2851910 CAGAGAGAACTATCTAAAGAAGG - Intronic
949596077 3:5548554-5548576 CAGAATAGAATTTGTAAGGATGG + Intergenic
952581577 3:34839435-34839457 CAGAGTAAAGAATATAAGGAAGG + Intergenic
953628666 3:44592586-44592608 AATAGTAAAGTATCTAAGGATGG - Intronic
955034723 3:55256185-55256207 TAGAGCAGGCTTTCTAAGGAAGG + Intergenic
957385779 3:79495063-79495085 CAGAGTATACATTCTAATCAGGG - Intronic
958425263 3:93972442-93972464 CAAAGTAAACTTTTTGAAGATGG - Intronic
958693144 3:97493908-97493930 CAGAGTAAAATCTATAAAGATGG + Intronic
959187357 3:103061626-103061648 AGAAGTTAACTTTCTAAGGATGG + Intergenic
963555510 3:146782637-146782659 CAAAGTAAAAATTCTAAGAAGGG + Intergenic
964551392 3:157888724-157888746 CAGAGCAAACTTGATAATGAGGG - Intergenic
966228169 3:177620439-177620461 CAGAATAAAATTTCCATGGAAGG + Intergenic
969370725 4:6729418-6729440 TAGAATGAACTTTCTGAGGAAGG + Intergenic
971571971 4:28224248-28224270 AAGAGGAAACATTCTAAGTAGGG - Intergenic
974731636 4:65874287-65874309 CAGAGTAAATTTTCTCAGTGCGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
981440282 4:144774854-144774876 GAGAGTATACATTCTAAGGAGGG + Intergenic
982954247 4:161742170-161742192 GAGAGAAAACTTGTTAAGGAGGG + Intronic
983435217 4:167706519-167706541 GAGAGTAGAGTTTCTAAGGCAGG + Intergenic
983766014 4:171485277-171485299 CAGTGTTAAATTTCTAAAGATGG - Intergenic
983916392 4:173296678-173296700 CAGTGTAAACTTTCCCAGGGAGG - Intronic
985422777 4:189801302-189801324 CAGAGTCAAGTTTCGCAGGATGG - Intergenic
985992923 5:3578212-3578234 CACAGGACACTTTCTGAGGAGGG - Intergenic
988306492 5:29500165-29500187 CAGAGGCAACTTTCTAAGACAGG - Intergenic
989598406 5:43179341-43179363 CAGACTAAACTTTCTAGGTCAGG - Intronic
990541221 5:56774379-56774401 CACAGCAAGCTTTCTAAAGATGG - Intergenic
991277199 5:64863256-64863278 CAGATTAAACATTCTTGGGATGG + Intronic
991434254 5:66580249-66580271 CAAAATGAACATTCTAAGGAGGG + Intergenic
994126818 5:96177134-96177156 CAGAGTAGATTTTTTAATGAGGG - Intergenic
995670289 5:114595252-114595274 CAGAGAAGATTTTTTAAGGATGG - Intergenic
998059540 5:139109016-139109038 CAGAAGAAAAGTTCTAAGGAAGG - Intronic
999664352 5:153897211-153897233 CAGATTATATTTTCTAAAGAAGG - Intergenic
1004576648 6:16902463-16902485 TAGAGTAAACTTTTTACAGATGG - Intergenic
1005582248 6:27246414-27246436 GAGAGCAAAAATTCTAAGGAAGG + Intergenic
1005925564 6:30442431-30442453 CAGAGTGAACTTTCTAATGTTGG - Intergenic
1009849610 6:69179453-69179475 CAGATTAAAATTTCAAAGCAAGG - Intronic
1011191450 6:84733866-84733888 CAGTGTAACCTATATAAGGAAGG - Exonic
1011954665 6:93011875-93011897 TAGAGGAAAATTTCTAAGGCAGG + Intergenic
1014065251 6:117117273-117117295 CAGGGCAAGCTTCCTAAGGAAGG - Intergenic
1014217771 6:118768964-118768986 CAGTGGAAACTTTCAGAGGAAGG + Intergenic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1019089942 6:169520099-169520121 CAGAGAAAAATTTCTAGGGTGGG - Intronic
1021040560 7:15857034-15857056 CAGTGCAAAATTTCTAAGGTGGG + Intergenic
1021910228 7:25378281-25378303 CAGACTCTCCTTTCTAAGGAAGG + Intergenic
1025850331 7:65239114-65239136 CAGCGTCAACTTTCCAAGGCGGG + Intergenic
1029358505 7:100070846-100070868 CAGAGGAACCTTTCCAAGGTGGG - Exonic
1029513809 7:101013367-101013389 CAGCATGAACTTTCTCAGGAAGG - Intronic
1030258390 7:107537097-107537119 CAGTGTAAAGTGTATAAGGAAGG - Intronic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1031643980 7:124201062-124201084 CAGAATAAATATTCCAAGGAAGG - Intergenic
1033380480 7:140812049-140812071 CATAGAAATCTTTCTAAAGAAGG + Intronic
1039286031 8:36041816-36041838 CTGCATAAACTTTCTAAGGCAGG + Intergenic
1039723000 8:40184950-40184972 CACAGTCAATTTTCTAAGGGAGG - Intergenic
1043927050 8:86049254-86049276 CAGAGTAAGCTTTCAAAGGGAGG - Intronic
1045801450 8:106105952-106105974 AAAAGTAAAGTTTCAAAGGAAGG - Intergenic
1047033410 8:120909006-120909028 CAGAGTAAACAGTCTACAGATGG + Intergenic
1047366109 8:124213060-124213082 CAGAGTAAACATTCTAGACAAGG + Intergenic
1047710281 8:127544943-127544965 GACAGCAAACTTTCTCAGGATGG - Intergenic
1050581637 9:7063462-7063484 CAGATTAATGTTTTTAAGGAGGG + Intronic
1051705488 9:19875082-19875104 AAGAGTAAACTTTCCATTGAAGG - Intergenic
1051978839 9:22988300-22988322 CAGTGTAAAATTTCTAATGTTGG + Intergenic
1052891512 9:33704537-33704559 CAGAGTGACCTTTCTAAGAGGGG - Intergenic
1052938122 9:34110493-34110515 CAGAGTCAACTTCCTAAAAATGG + Intronic
1053171572 9:35890220-35890242 AAGAAAAAACTTTTTAAGGATGG - Intergenic
1056079993 9:83082193-83082215 GAGAGAAAACTTCCTAAGTACGG - Intergenic
1056274299 9:84978176-84978198 AAGATTAAACTTAGTAAGGAAGG + Intronic
1056552274 9:87661903-87661925 CAGGGAAAACTTTCTAAACATGG - Intronic
1060862671 9:126967877-126967899 GAATATAAACTTTCTAAGGACGG + Intronic
1061598866 9:131652117-131652139 CAGGGTAAACTTTATAACCATGG + Intronic
1187471419 X:19573269-19573291 AAAAGTAAACTTTAAAAGGAAGG - Intronic
1188080190 X:25829307-25829329 CAGTGTAAAACTTCTAAGCAGGG + Intergenic
1189077791 X:37936269-37936291 CAGATTATATTTTCTAAAGATGG - Intronic
1189715782 X:43864655-43864677 CAGAGTCAGCTTTTAAAGGACGG + Intronic
1189773851 X:44452467-44452489 CAGACTATATTTTCCAAGGATGG + Intergenic
1195735631 X:108009809-108009831 CAGAGAAAAATTTCTAGGGCTGG + Intergenic
1196274060 X:113745705-113745727 CAGAGTATACTTTCTGAGATGGG - Intergenic
1197342724 X:125292737-125292759 TAGAGTAAACTTTTTATGCAAGG + Intergenic
1200594165 Y:5117245-5117267 CAGAGTAATATTGCTAAGAAAGG - Intronic
1200952502 Y:8913542-8913564 TAGTGAAAACTTTCTAATGATGG - Intergenic
1202160506 Y:21930049-21930071 TAGTGAAAACTTTCTAATGATGG + Intergenic
1202198184 Y:22318227-22318249 TAGTGAAAACTTTCTAATGATGG - Intronic
1202230850 Y:22656326-22656348 TAGTGAAAACTTTCTAATGATGG - Intergenic
1202312308 Y:23539839-23539861 TAGTGAAAACTTTCTAATGATGG + Intergenic
1202558495 Y:26130755-26130777 TAGTGAAAACTTTCTAATGATGG - Intergenic