ID: 1066368363

View in Genome Browser
Species Human (GRCh38)
Location 10:34798342-34798364
Sequence AAGGAGAAGGAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066368357_1066368363 -8 Left 1066368357 10:34798327-34798349 CCCTGTCCCGTGAAGAAGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
1066368354_1066368363 21 Left 1066368354 10:34798298-34798320 CCAACCTGGGGAACACAGCAAGT 0: 1
1: 4
2: 307
3: 5720
4: 48165
Right 1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
1066368358_1066368363 -9 Left 1066368358 10:34798328-34798350 CCTGTCCCGTGAAGAAGGAGAAG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
1066368355_1066368363 17 Left 1066368355 10:34798302-34798324 CCTGGGGAACACAGCAAGTGCAA 0: 1
1: 0
2: 1
3: 56
4: 692
Right 1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG 0: 25
1: 106
2: 378
3: 1647
4: 6294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066368363 Original CRISPR AAGGAGAAGGAGAAGGAGAA AGG Intronic
Too many off-targets to display for this crispr