ID: 1066372129

View in Genome Browser
Species Human (GRCh38)
Location 10:34826130-34826152
Sequence CCTGTGCTGCAGAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066372125_1066372129 -10 Left 1066372125 10:34826117-34826139 CCTAACATGTCTTCCTGTGCTGC No data
Right 1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066372129 Original CRISPR CCTGTGCTGCAGAGGCTGGA AGG Intergenic
No off target data available for this crispr