ID: 1066374337 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:34843920-34843942 |
Sequence | GCCTGATCACCCGGGATTAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1066374334_1066374337 | -3 | Left | 1066374334 | 10:34843900-34843922 | CCAGGAAAGAGTTAGTGAAAGCC | No data | ||
Right | 1066374337 | 10:34843920-34843942 | GCCTGATCACCCGGGATTATAGG | No data | ||||
1066374332_1066374337 | 21 | Left | 1066374332 | 10:34843876-34843898 | CCAGCTCAGAAGTTGTTGAGTAT | No data | ||
Right | 1066374337 | 10:34843920-34843942 | GCCTGATCACCCGGGATTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1066374337 | Original CRISPR | GCCTGATCACCCGGGATTAT AGG | Intergenic | ||