ID: 1066374337

View in Genome Browser
Species Human (GRCh38)
Location 10:34843920-34843942
Sequence GCCTGATCACCCGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066374334_1066374337 -3 Left 1066374334 10:34843900-34843922 CCAGGAAAGAGTTAGTGAAAGCC No data
Right 1066374337 10:34843920-34843942 GCCTGATCACCCGGGATTATAGG No data
1066374332_1066374337 21 Left 1066374332 10:34843876-34843898 CCAGCTCAGAAGTTGTTGAGTAT No data
Right 1066374337 10:34843920-34843942 GCCTGATCACCCGGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066374337 Original CRISPR GCCTGATCACCCGGGATTAT AGG Intergenic